Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631818_at:

>probe:Drosophila_2:1631818_at:210:547; Interrogation_Position=106; Antisense; GGATGGATGGCTCCGCCAAAGAACC
>probe:Drosophila_2:1631818_at:628:107; Interrogation_Position=125; Antisense; AGAACCGGGGCCTAATTCAATATAT
>probe:Drosophila_2:1631818_at:568:711; Interrogation_Position=140; Antisense; TTCAATATATCGTGGCTAAGCTGGC
>probe:Drosophila_2:1631818_at:638:263; Interrogation_Position=170; Antisense; CAGTAGTTACTTTTGTCAAACTGAA
>probe:Drosophila_2:1631818_at:41:495; Interrogation_Position=184; Antisense; GTCAAACTGAACATTTCTGAGCGAT
>probe:Drosophila_2:1631818_at:377:385; Interrogation_Position=192; Antisense; GAACATTTCTGAGCGATTGACAAAA
>probe:Drosophila_2:1631818_at:590:623; Interrogation_Position=29; Antisense; TGCGAAAACCTATTGCTCAGGATCT
>probe:Drosophila_2:1631818_at:628:175; Interrogation_Position=34; Antisense; AAACCTATTGCTCAGGATCTCCTGA
>probe:Drosophila_2:1631818_at:161:691; Interrogation_Position=39; Antisense; TATTGCTCAGGATCTCCTGACTTCT
>probe:Drosophila_2:1631818_at:300:77; Interrogation_Position=47; Antisense; AGGATCTCCTGACTTCTCCGGAGGC
>probe:Drosophila_2:1631818_at:448:611; Interrogation_Position=56; Antisense; TGACTTCTCCGGAGGCATGGCGCTA
>probe:Drosophila_2:1631818_at:500:693; Interrogation_Position=60; Antisense; TTCTCCGGAGGCATGGCGCTACTTT
>probe:Drosophila_2:1631818_at:203:439; Interrogation_Position=67; Antisense; GAGGCATGGCGCTACTTTGAGTATG
>probe:Drosophila_2:1631818_at:477:269; Interrogation_Position=71; Antisense; CATGGCGCTACTTTGAGTATGGCAT

Paste this into a BLAST search page for me
GGATGGATGGCTCCGCCAAAGAACCAGAACCGGGGCCTAATTCAATATATTTCAATATATCGTGGCTAAGCTGGCCAGTAGTTACTTTTGTCAAACTGAAGTCAAACTGAACATTTCTGAGCGATGAACATTTCTGAGCGATTGACAAAATGCGAAAACCTATTGCTCAGGATCTAAACCTATTGCTCAGGATCTCCTGATATTGCTCAGGATCTCCTGACTTCTAGGATCTCCTGACTTCTCCGGAGGCTGACTTCTCCGGAGGCATGGCGCTATTCTCCGGAGGCATGGCGCTACTTTGAGGCATGGCGCTACTTTGAGTATGCATGGCGCTACTTTGAGTATGGCAT

Full Affymetrix probeset data:

Annotations for 1631818_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime