Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631819_s_at:

>probe:Drosophila_2:1631819_s_at:318:43; Interrogation_Position=113; Antisense; ATCGTAATGGCATCAAGCGCCCGCT
>probe:Drosophila_2:1631819_s_at:191:309; Interrogation_Position=147; Antisense; CCACGAGTCCACTCTGGGTATGGAT
>probe:Drosophila_2:1631819_s_at:285:163; Interrogation_Position=175; Antisense; AAATTTCTGATCAACCAGCGCTACG
>probe:Drosophila_2:1631819_s_at:121:299; Interrogation_Position=193; Antisense; CGCTACGCACGCAAGGGAAACCTTT
>probe:Drosophila_2:1631819_s_at:158:293; Interrogation_Position=222; Antisense; CGAGGAGTCCGTGAAGCGCTACAAC
>probe:Drosophila_2:1631819_s_at:418:205; Interrogation_Position=235; Antisense; AAGCGCTACAACGAGCGCATCGCTT
>probe:Drosophila_2:1631819_s_at:339:45; Interrogation_Position=253; Antisense; ATCGCTTCCCAGAAGGGCAAGCCAA
>probe:Drosophila_2:1631819_s_at:37:361; Interrogation_Position=269; Antisense; GCAAGCCAAAGCCTGTTACTCTGTA
>probe:Drosophila_2:1631819_s_at:45:475; Interrogation_Position=283; Antisense; GTTACTCTGTAGATGATTGCCCCGC
>probe:Drosophila_2:1631819_s_at:78:465; Interrogation_Position=297; Antisense; GATTGCCCCGCGTGTGGATAATTAA
>probe:Drosophila_2:1631819_s_at:678:561; Interrogation_Position=36; Antisense; GGAATTCCAGTGTGCGAAAAACTTT
>probe:Drosophila_2:1631819_s_at:323:173; Interrogation_Position=54; Antisense; AAACTTTAAGATGGCCAAGTCCAAG
>probe:Drosophila_2:1631819_s_at:266:109; Interrogation_Position=77; Antisense; AGAACCACACAAATCACAACCAGAA
>probe:Drosophila_2:1631819_s_at:44:201; Interrogation_Position=94; Antisense; AACCAGAACAAGAAGGCCCATCGTA

Paste this into a BLAST search page for me
ATCGTAATGGCATCAAGCGCCCGCTCCACGAGTCCACTCTGGGTATGGATAAATTTCTGATCAACCAGCGCTACGCGCTACGCACGCAAGGGAAACCTTTCGAGGAGTCCGTGAAGCGCTACAACAAGCGCTACAACGAGCGCATCGCTTATCGCTTCCCAGAAGGGCAAGCCAAGCAAGCCAAAGCCTGTTACTCTGTAGTTACTCTGTAGATGATTGCCCCGCGATTGCCCCGCGTGTGGATAATTAAGGAATTCCAGTGTGCGAAAAACTTTAAACTTTAAGATGGCCAAGTCCAAGAGAACCACACAAATCACAACCAGAAAACCAGAACAAGAAGGCCCATCGTA

Full Affymetrix probeset data:

Annotations for 1631819_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime