FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631820_at:

>probe:Drosophila_2:1631820_at:405:619; Interrogation_Position=321; Antisense; TGCTGCTAAACCAGTGGCCCATGAA
>probe:Drosophila_2:1631820_at:493:267; Interrogation_Position=340; Antisense; CATGAACTTGGTCCCGGTCGCAGAA
>probe:Drosophila_2:1631820_at:721:243; Interrogation_Position=380; Antisense; AATTTGTTGACCATCTTTAGCTCCA
>probe:Drosophila_2:1631820_at:622:705; Interrogation_Position=396; Antisense; TTAGCTCCATTGTGTACGGACTGTC
>probe:Drosophila_2:1631820_at:214:289; Interrogation_Position=412; Antisense; CGGACTGTCGCTGATCAACATGGGC
>probe:Drosophila_2:1631820_at:332:267; Interrogation_Position=439; Antisense; CAGTCTGCTGCTGCTGATTGGTATT
>probe:Drosophila_2:1631820_at:94:305; Interrogation_Position=466; Antisense; CCGGGACTCAAGCTGCCTAATTTAT
>probe:Drosophila_2:1631820_at:519:47; Interrogation_Position=489; Antisense; ATCCTTGGCTGATCTATCATGGCGT
>probe:Drosophila_2:1631820_at:330:725; Interrogation_Position=570; Antisense; TTGACCTGTCGAGCTTTCTAATGTG
>probe:Drosophila_2:1631820_at:13:281; Interrogation_Position=587; Antisense; CTAATGTGTCTTCTGGTGTTCAACC
>probe:Drosophila_2:1631820_at:589:133; Interrogation_Position=653; Antisense; ACCCTATTTCGCGTGATGGAGCAGC
>probe:Drosophila_2:1631820_at:279:367; Interrogation_Position=693; Antisense; GAATGGGCGGACTCTACTACCAGGA
>probe:Drosophila_2:1631820_at:576:541; Interrogation_Position=745; Antisense; GGTTCCCTTTCAACATGTCTATGTG
>probe:Drosophila_2:1631820_at:18:321; Interrogation_Position=769; Antisense; GCCGCGTCTGCCGATGCAAAAGTAA

Paste this into a BLAST search page for me
TGCTGCTAAACCAGTGGCCCATGAACATGAACTTGGTCCCGGTCGCAGAAAATTTGTTGACCATCTTTAGCTCCATTAGCTCCATTGTGTACGGACTGTCCGGACTGTCGCTGATCAACATGGGCCAGTCTGCTGCTGCTGATTGGTATTCCGGGACTCAAGCTGCCTAATTTATATCCTTGGCTGATCTATCATGGCGTTTGACCTGTCGAGCTTTCTAATGTGCTAATGTGTCTTCTGGTGTTCAACCACCCTATTTCGCGTGATGGAGCAGCGAATGGGCGGACTCTACTACCAGGAGGTTCCCTTTCAACATGTCTATGTGGCCGCGTCTGCCGATGCAAAAGTAA

Full Affymetrix probeset data:

Annotations for 1631820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720