Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631821_at:

>probe:Drosophila_2:1631821_at:562:497; Interrogation_Position=1458; Antisense; GTCTACAACTTCTACAACGTCTACA
>probe:Drosophila_2:1631821_at:673:249; Interrogation_Position=1541; Antisense; CAATAATGATCCCTACTTCCAGTAC
>probe:Drosophila_2:1631821_at:242:405; Interrogation_Position=1572; Antisense; GACTACAGGCATCAACACCACAATG
>probe:Drosophila_2:1631821_at:41:187; Interrogation_Position=1599; Antisense; AACACGGAAGCGCATCACTTGGAAC
>probe:Drosophila_2:1631821_at:264:275; Interrogation_Position=1616; Antisense; CTTGGAACGTTGATCCTCAGGACAT
>probe:Drosophila_2:1631821_at:145:153; Interrogation_Position=1649; Antisense; ACATGGACACGAGCGGAAGTACCCC
>probe:Drosophila_2:1631821_at:275:699; Interrogation_Position=1683; Antisense; TTTAGTAGTACTTTACCTGCTCCTC
>probe:Drosophila_2:1631821_at:122:283; Interrogation_Position=1705; Antisense; CTCGCCATTGTTCTGGTGGTAGTTC
>probe:Drosophila_2:1631821_at:625:483; Interrogation_Position=1723; Antisense; GTAGTTCTGGCCAACGTCGTTAATC
>probe:Drosophila_2:1631821_at:532:547; Interrogation_Position=1851; Antisense; GGATGATCAGCCGTTATGCGACTCC
>probe:Drosophila_2:1631821_at:671:681; Interrogation_Position=1865; Antisense; TATGCGACTCCGATAACGACGATGT
>probe:Drosophila_2:1631821_at:199:559; Interrogation_Position=1914; Antisense; GGACATACGACATAGGACCGATCTA
>probe:Drosophila_2:1631821_at:512:403; Interrogation_Position=1929; Antisense; GACCGATCTATGAGGGTAATCCCCA
>probe:Drosophila_2:1631821_at:659:197; Interrogation_Position=1968; Antisense; AACGCTTAGGACTGTGCCTATTGTA

Paste this into a BLAST search page for me
GTCTACAACTTCTACAACGTCTACACAATAATGATCCCTACTTCCAGTACGACTACAGGCATCAACACCACAATGAACACGGAAGCGCATCACTTGGAACCTTGGAACGTTGATCCTCAGGACATACATGGACACGAGCGGAAGTACCCCTTTAGTAGTACTTTACCTGCTCCTCCTCGCCATTGTTCTGGTGGTAGTTCGTAGTTCTGGCCAACGTCGTTAATCGGATGATCAGCCGTTATGCGACTCCTATGCGACTCCGATAACGACGATGTGGACATACGACATAGGACCGATCTAGACCGATCTATGAGGGTAATCCCCAAACGCTTAGGACTGTGCCTATTGTA

Full Affymetrix probeset data:

Annotations for 1631821_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime