FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631822_at:

>probe:Drosophila_2:1631822_at:190:623; Interrogation_Position=6577; Antisense; TGCGTGATCGACTGTGGCCGCCAAA
>probe:Drosophila_2:1631822_at:74:345; Interrogation_Position=6611; Antisense; GCATTTGCCCAGACTGCCTGAAAAA
>probe:Drosophila_2:1631822_at:724:139; Interrogation_Position=6643; Antisense; ACGTGCGTAGTTGTGCTCTCAGATA
>probe:Drosophila_2:1631822_at:308:525; Interrogation_Position=6687; Antisense; GGGCTACCAACTAACTCGGCAGATA
>probe:Drosophila_2:1631822_at:36:459; Interrogation_Position=6708; Antisense; GATATGCCAGGCTTGTTGCGGACGC
>probe:Drosophila_2:1631822_at:516:467; Interrogation_Position=6722; Antisense; GTTGCGGACGCCTGGGTAGCCTACA
>probe:Drosophila_2:1631822_at:347:487; Interrogation_Position=6737; Antisense; GTAGCCTACAGTGTGATTCCCTCGA
>probe:Drosophila_2:1631822_at:708:143; Interrogation_Position=6761; Antisense; ACTGCCCAGTGCTGTATGTCTTGGA
>probe:Drosophila_2:1631822_at:243:561; Interrogation_Position=6821; Antisense; GGAACAAACTCCTTGAACACCACTT
>probe:Drosophila_2:1631822_at:536:187; Interrogation_Position=6836; Antisense; AACACCACTTCTAATGCCAATCAAT
>probe:Drosophila_2:1631822_at:584:145; Interrogation_Position=6861; Antisense; ACTCGTATGCAGGTTGGATTTCTCA
>probe:Drosophila_2:1631822_at:71:483; Interrogation_Position=6904; Antisense; GTATTTTAACTTGCAGCTCGCTTAT
>probe:Drosophila_2:1631822_at:697:313; Interrogation_Position=6957; Antisense; GCCAGTGCTTCTAAACATGTACGTA
>probe:Drosophila_2:1631822_at:30:343; Interrogation_Position=6982; Antisense; GCTTATACTCTACTTATGCATTGGG

Paste this into a BLAST search page for me
TGCGTGATCGACTGTGGCCGCCAAAGCATTTGCCCAGACTGCCTGAAAAAACGTGCGTAGTTGTGCTCTCAGATAGGGCTACCAACTAACTCGGCAGATAGATATGCCAGGCTTGTTGCGGACGCGTTGCGGACGCCTGGGTAGCCTACAGTAGCCTACAGTGTGATTCCCTCGAACTGCCCAGTGCTGTATGTCTTGGAGGAACAAACTCCTTGAACACCACTTAACACCACTTCTAATGCCAATCAATACTCGTATGCAGGTTGGATTTCTCAGTATTTTAACTTGCAGCTCGCTTATGCCAGTGCTTCTAAACATGTACGTAGCTTATACTCTACTTATGCATTGGG

Full Affymetrix probeset data:

Annotations for 1631822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720