Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631824_at:

>probe:Drosophila_2:1631824_at:727:249; Interrogation_Position=2965; Antisense; CAAGTCTTTCAGGTGGTAGGCGAAG
>probe:Drosophila_2:1631824_at:619:441; Interrogation_Position=3085; Antisense; GATGGTATTGATCCGGAGCACGATA
>probe:Drosophila_2:1631824_at:298:419; Interrogation_Position=3100; Antisense; GAGCACGATAGTGCCTTGCGTCGTT
>probe:Drosophila_2:1631824_at:84:275; Interrogation_Position=3114; Antisense; CTTGCGTCGTTTTCTTAGCAGTGGA
>probe:Drosophila_2:1631824_at:658:483; Interrogation_Position=3151; Antisense; GTAGGAAATTCCAGCGCAGCAGGTG
>probe:Drosophila_2:1631824_at:435:629; Interrogation_Position=3196; Antisense; TCCATCGCGGATGACACATGTGAGG
>probe:Drosophila_2:1631824_at:624:205; Interrogation_Position=3235; Antisense; AAGCGTCGGCTCAAGAAGCGCGTGC
>probe:Drosophila_2:1631824_at:578:181; Interrogation_Position=3290; Antisense; AAAACTCTCAGGATTCGCGCGATGG
>probe:Drosophila_2:1631824_at:202:441; Interrogation_Position=3310; Antisense; GATGGCGGCAACATGTCTGCCTTGG
>probe:Drosophila_2:1631824_at:503:227; Interrogation_Position=3342; Antisense; CAAGGACCAGGATTCCGGTTTCGAG
>probe:Drosophila_2:1631824_at:374:633; Interrogation_Position=3372; Antisense; TCCGCGGGCAGAGCGCAGCAAGATA
>probe:Drosophila_2:1631824_at:233:39; Interrogation_Position=3442; Antisense; ATCTACGCCACATTGGATGGACGCT
>probe:Drosophila_2:1631824_at:540:335; Interrogation_Position=3464; Antisense; GCTCCTGCAGCAGCCGGATGGAAAA
>probe:Drosophila_2:1631824_at:64:303; Interrogation_Position=3533; Antisense; CCCGGTCCATACAGCGCAATATTAG

Paste this into a BLAST search page for me
CAAGTCTTTCAGGTGGTAGGCGAAGGATGGTATTGATCCGGAGCACGATAGAGCACGATAGTGCCTTGCGTCGTTCTTGCGTCGTTTTCTTAGCAGTGGAGTAGGAAATTCCAGCGCAGCAGGTGTCCATCGCGGATGACACATGTGAGGAAGCGTCGGCTCAAGAAGCGCGTGCAAAACTCTCAGGATTCGCGCGATGGGATGGCGGCAACATGTCTGCCTTGGCAAGGACCAGGATTCCGGTTTCGAGTCCGCGGGCAGAGCGCAGCAAGATAATCTACGCCACATTGGATGGACGCTGCTCCTGCAGCAGCCGGATGGAAAACCCGGTCCATACAGCGCAATATTAG

Full Affymetrix probeset data:

Annotations for 1631824_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime