FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631827_at:

>probe:Drosophila_2:1631827_at:16:539; Interrogation_Position=105; Antisense; GGTAATGGATAAACGCCGCCAAGAA
>probe:Drosophila_2:1631827_at:177:175; Interrogation_Position=128; Antisense; AAACCCGGCAGGCAATGCGGCTGAT
>probe:Drosophila_2:1631827_at:569:391; Interrogation_Position=171; Antisense; GAAAGTTTGGATCACTATTGGCAGT
>probe:Drosophila_2:1631827_at:424:259; Interrogation_Position=183; Antisense; CACTATTGGCAGTATGCTAGTCAAA
>probe:Drosophila_2:1631827_at:534:387; Interrogation_Position=217; Antisense; GAAAAGGCATTGGAACTGCTCAAAA
>probe:Drosophila_2:1631827_at:545:713; Interrogation_Position=296; Antisense; TTCTGGTGAACAAACATCGCGATTT
>probe:Drosophila_2:1631827_at:676:17; Interrogation_Position=317; Antisense; ATTTGGAGTTCAAATCGCCCTTCTC
>probe:Drosophila_2:1631827_at:402:321; Interrogation_Position=333; Antisense; GCCCTTCTCGGGTACACATCTTAAG
>probe:Drosophila_2:1631827_at:674:537; Interrogation_Position=343; Antisense; GGTACACATCTTAAGCCCTTAGAAA
>probe:Drosophila_2:1631827_at:496:75; Interrogation_Position=371; Antisense; AGGAGTTCGACGCTCTGAAAGCAAA
>probe:Drosophila_2:1631827_at:98:393; Interrogation_Position=387; Antisense; GAAAGCAAATCTCCCATTACTGTGA
>probe:Drosophila_2:1631827_at:154:253; Interrogation_Position=54; Antisense; CAAGACCGAGGAGTTGGCCGACAAA
>probe:Drosophila_2:1631827_at:86:429; Interrogation_Position=64; Antisense; GAGTTGGCCGACAAAATTCTGGTCA
>probe:Drosophila_2:1631827_at:554:203; Interrogation_Position=91; Antisense; AAGCAGGAACTGACGGTAATGGATA

Paste this into a BLAST search page for me
GGTAATGGATAAACGCCGCCAAGAAAAACCCGGCAGGCAATGCGGCTGATGAAAGTTTGGATCACTATTGGCAGTCACTATTGGCAGTATGCTAGTCAAAGAAAAGGCATTGGAACTGCTCAAAATTCTGGTGAACAAACATCGCGATTTATTTGGAGTTCAAATCGCCCTTCTCGCCCTTCTCGGGTACACATCTTAAGGGTACACATCTTAAGCCCTTAGAAAAGGAGTTCGACGCTCTGAAAGCAAAGAAAGCAAATCTCCCATTACTGTGACAAGACCGAGGAGTTGGCCGACAAAGAGTTGGCCGACAAAATTCTGGTCAAAGCAGGAACTGACGGTAATGGATA

Full Affymetrix probeset data:

Annotations for 1631827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720