Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631829_at:

>probe:Drosophila_2:1631829_at:540:457; Interrogation_Position=103; Antisense; GATAGCGATGCGAGCGATACCGAAT
>probe:Drosophila_2:1631829_at:110:61; Interrogation_Position=133; Antisense; ATGGTTCAATTTGTGGACGATCCGA
>probe:Drosophila_2:1631829_at:153:567; Interrogation_Position=15; Antisense; GGCACCCAATCGCAAGGACGGAAAG
>probe:Drosophila_2:1631829_at:581:447; Interrogation_Position=151; Antisense; GATCCGAATGTCCTGCGAGTTGCGA
>probe:Drosophila_2:1631829_at:187:429; Interrogation_Position=167; Antisense; GAGTTGCGATCATAGCTTGTCCTGT
>probe:Drosophila_2:1631829_at:199:117; Interrogation_Position=180; Antisense; AGCTTGTCCTGTAGAGACGCCACAA
>probe:Drosophila_2:1631829_at:273:263; Interrogation_Position=217; Antisense; CAGTTCTTTCTCACGGTTTACAGGA
>probe:Drosophila_2:1631829_at:488:551; Interrogation_Position=239; Antisense; GGAGATCCAATATCGGCATTGTCAT
>probe:Drosophila_2:1631829_at:210:729; Interrogation_Position=257; Antisense; TTGTCATCATCGACTACGATACGGT
>probe:Drosophila_2:1631829_at:126:185; Interrogation_Position=283; Antisense; AAAAGGCTTCGTACCATGATGCAAC
>probe:Drosophila_2:1631829_at:445:445; Interrogation_Position=300; Antisense; GATGCAACGATGTTCTCAGCTGCTT
>probe:Drosophila_2:1631829_at:270:505; Interrogation_Position=328; Antisense; GTCCTGGTCACGGTGCCCAACAAAT
>probe:Drosophila_2:1631829_at:342:185; Interrogation_Position=346; Antisense; AACAAATCCTCACTGATCACGTACT
>probe:Drosophila_2:1631829_at:490:149; Interrogation_Position=396; Antisense; ACTTCGCCAGCGTGATGCCTATTAG

Paste this into a BLAST search page for me
GATAGCGATGCGAGCGATACCGAATATGGTTCAATTTGTGGACGATCCGAGGCACCCAATCGCAAGGACGGAAAGGATCCGAATGTCCTGCGAGTTGCGAGAGTTGCGATCATAGCTTGTCCTGTAGCTTGTCCTGTAGAGACGCCACAACAGTTCTTTCTCACGGTTTACAGGAGGAGATCCAATATCGGCATTGTCATTTGTCATCATCGACTACGATACGGTAAAAGGCTTCGTACCATGATGCAACGATGCAACGATGTTCTCAGCTGCTTGTCCTGGTCACGGTGCCCAACAAATAACAAATCCTCACTGATCACGTACTACTTCGCCAGCGTGATGCCTATTAG

Full Affymetrix probeset data:

Annotations for 1631829_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime