FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631831_at:

>probe:Drosophila_2:1631831_at:210:5; Interrogation_Position=1758; Antisense; ATTGAAACTCACTTGGCGCACATTC
>probe:Drosophila_2:1631831_at:173:455; Interrogation_Position=1797; Antisense; GATCACGCTGCGTCGGGCATTGAAA
>probe:Drosophila_2:1631831_at:605:5; Interrogation_Position=1815; Antisense; ATTGAAATGCCCTCGTTCAGCTTCG
>probe:Drosophila_2:1631831_at:585:91; Interrogation_Position=1870; Antisense; AGTATCTACTGACTTTGCCGCAGCA
>probe:Drosophila_2:1631831_at:468:713; Interrogation_Position=1922; Antisense; TTCTCTGCTGAAACAGGCTCTCGAG
>probe:Drosophila_2:1631831_at:405:69; Interrogation_Position=1936; Antisense; AGGCTCTCGAGGTGTGCAACATCAA
>probe:Drosophila_2:1631831_at:93:653; Interrogation_Position=1957; Antisense; TCAAGTATACGCAGGCCATTCCATG
>probe:Drosophila_2:1631831_at:431:115; Interrogation_Position=2011; Antisense; AGCAGTGCTGTGTTCTGTACGTTAC
>probe:Drosophila_2:1631831_at:532:571; Interrogation_Position=2072; Antisense; GGCTACTCAGCTCAGCGTGGATATC
>probe:Drosophila_2:1631831_at:421:457; Interrogation_Position=2091; Antisense; GATATCGAGTACCTGTCCAACGTTC
>probe:Drosophila_2:1631831_at:69:215; Interrogation_Position=2119; Antisense; AAGAGTTGGGCTTGTCCATCAACCT
>probe:Drosophila_2:1631831_at:135:203; Interrogation_Position=2139; Antisense; AACCTTCAGTTGTCTCAGATCCTCA
>probe:Drosophila_2:1631831_at:170:339; Interrogation_Position=2168; Antisense; GCTAAAGGCTGCTCCAGATCAGTAT
>probe:Drosophila_2:1631831_at:150:447; Interrogation_Position=2209; Antisense; GATGCGAGCCGCGACTGGTAACAGC

Paste this into a BLAST search page for me
ATTGAAACTCACTTGGCGCACATTCGATCACGCTGCGTCGGGCATTGAAAATTGAAATGCCCTCGTTCAGCTTCGAGTATCTACTGACTTTGCCGCAGCATTCTCTGCTGAAACAGGCTCTCGAGAGGCTCTCGAGGTGTGCAACATCAATCAAGTATACGCAGGCCATTCCATGAGCAGTGCTGTGTTCTGTACGTTACGGCTACTCAGCTCAGCGTGGATATCGATATCGAGTACCTGTCCAACGTTCAAGAGTTGGGCTTGTCCATCAACCTAACCTTCAGTTGTCTCAGATCCTCAGCTAAAGGCTGCTCCAGATCAGTATGATGCGAGCCGCGACTGGTAACAGC

Full Affymetrix probeset data:

Annotations for 1631831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720