Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631832_at:

>probe:Drosophila_2:1631832_at:104:681; Interrogation_Position=1018; Antisense; TTATCAACTAGTGCAGTCGTTCTTT
>probe:Drosophila_2:1631832_at:182:343; Interrogation_Position=1030; Antisense; GCAGTCGTTCTTTTGTACCAATCAC
>probe:Drosophila_2:1631832_at:604:487; Interrogation_Position=1044; Antisense; GTACCAATCACACTCGATACATTTA
>probe:Drosophila_2:1631832_at:242:369; Interrogation_Position=1112; Antisense; GAAGGAAAGCCAGAGTATCACGAAA
>probe:Drosophila_2:1631832_at:445:663; Interrogation_Position=1151; Antisense; TAAAGCTGATATGCGTCGGTGGCGT
>probe:Drosophila_2:1631832_at:582:639; Interrogation_Position=1166; Antisense; TCGGTGGCGTGTGTCCGTATTTAAA
>probe:Drosophila_2:1631832_at:252:517; Interrogation_Position=1176; Antisense; GTGTCCGTATTTAAATGCGCATTTT
>probe:Drosophila_2:1631832_at:712:443; Interrogation_Position=1266; Antisense; GATCCAATGAATGTGTAGGTCTTTT
>probe:Drosophila_2:1631832_at:722:513; Interrogation_Position=743; Antisense; GTGATTCCAACTTAGCCATTCTTAC
>probe:Drosophila_2:1631832_at:165:641; Interrogation_Position=762; Antisense; TCTTACCCCGGCATTAAAGCATTCA
>probe:Drosophila_2:1631832_at:385:559; Interrogation_Position=794; Antisense; GGACAACGACCAAGGATATCGAGAT
>probe:Drosophila_2:1631832_at:70:671; Interrogation_Position=883; Antisense; TACGAGATTGGAGCTATTCCCACTT
>probe:Drosophila_2:1631832_at:649:417; Interrogation_Position=893; Antisense; GAGCTATTCCCACTTCCAAAATTAA
>probe:Drosophila_2:1631832_at:278:275; Interrogation_Position=954; Antisense; CTAATTACCGCGTCTGTGAATGTGC

Paste this into a BLAST search page for me
TTATCAACTAGTGCAGTCGTTCTTTGCAGTCGTTCTTTTGTACCAATCACGTACCAATCACACTCGATACATTTAGAAGGAAAGCCAGAGTATCACGAAATAAAGCTGATATGCGTCGGTGGCGTTCGGTGGCGTGTGTCCGTATTTAAAGTGTCCGTATTTAAATGCGCATTTTGATCCAATGAATGTGTAGGTCTTTTGTGATTCCAACTTAGCCATTCTTACTCTTACCCCGGCATTAAAGCATTCAGGACAACGACCAAGGATATCGAGATTACGAGATTGGAGCTATTCCCACTTGAGCTATTCCCACTTCCAAAATTAACTAATTACCGCGTCTGTGAATGTGC

Full Affymetrix probeset data:

Annotations for 1631832_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime