FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631833_at:

>probe:Drosophila_2:1631833_at:394:265; Interrogation_Position=1364; Antisense; CAGAGGCTCAAGATGGCCCAAGCAA
>probe:Drosophila_2:1631833_at:174:211; Interrogation_Position=1383; Antisense; AAGCAAGGACACTGCCATCCCGAAG
>probe:Drosophila_2:1631833_at:90:379; Interrogation_Position=1404; Antisense; GAAGCCCGCGGAGCATCCAAGGAAA
>probe:Drosophila_2:1631833_at:540:141; Interrogation_Position=1435; Antisense; ACTGATAGCGTGCAGAAGTCCCCTA
>probe:Drosophila_2:1631833_at:191:219; Interrogation_Position=1450; Antisense; AAGTCCCCTAGAGATGCTGACGCTA
>probe:Drosophila_2:1631833_at:252:135; Interrogation_Position=1469; Antisense; ACGCTATCCCCTTGTTCGATGGCAG
>probe:Drosophila_2:1631833_at:560:67; Interrogation_Position=1487; Antisense; ATGGCAGCCGGGTCTTTGTGTCCAA
>probe:Drosophila_2:1631833_at:462:521; Interrogation_Position=1513; Antisense; GTGGCTCTGGCCAAGGCGTATATCC
>probe:Drosophila_2:1631833_at:105:329; Interrogation_Position=1528; Antisense; GCGTATATCCCCATGCCGATGATAT
>probe:Drosophila_2:1631833_at:677:27; Interrogation_Position=1553; Antisense; ATACGTGCCGTGTGATGGATCTGGT
>probe:Drosophila_2:1631833_at:646:549; Interrogation_Position=1617; Antisense; GGAGACCACGGACAAGGACCTGATC
>probe:Drosophila_2:1631833_at:608:267; Interrogation_Position=1657; Antisense; CATGTGTGTAAAGTGTTTGCCCTGC
>probe:Drosophila_2:1631833_at:84:351; Interrogation_Position=1705; Antisense; GCAGTACAGGAGTTCATTGACCACA
>probe:Drosophila_2:1631833_at:703:723; Interrogation_Position=1721; Antisense; TTGACCACAAGCTGTCTACTCTTAA

Paste this into a BLAST search page for me
CAGAGGCTCAAGATGGCCCAAGCAAAAGCAAGGACACTGCCATCCCGAAGGAAGCCCGCGGAGCATCCAAGGAAAACTGATAGCGTGCAGAAGTCCCCTAAAGTCCCCTAGAGATGCTGACGCTAACGCTATCCCCTTGTTCGATGGCAGATGGCAGCCGGGTCTTTGTGTCCAAGTGGCTCTGGCCAAGGCGTATATCCGCGTATATCCCCATGCCGATGATATATACGTGCCGTGTGATGGATCTGGTGGAGACCACGGACAAGGACCTGATCCATGTGTGTAAAGTGTTTGCCCTGCGCAGTACAGGAGTTCATTGACCACATTGACCACAAGCTGTCTACTCTTAA

Full Affymetrix probeset data:

Annotations for 1631833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720