FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631834_at:

>probe:Drosophila_2:1631834_at:257:717; Interrogation_Position=1008; Antisense; TTCCTCTACGGATCCTTGAACGAGA
>probe:Drosophila_2:1631834_at:484:421; Interrogation_Position=1029; Antisense; GAGAATGTTCGTAAGGTCCACTATA
>probe:Drosophila_2:1631834_at:680:431; Interrogation_Position=1078; Antisense; GAGTGCTTCAGCAGACCCTGGAGAA
>probe:Drosophila_2:1631834_at:543:497; Interrogation_Position=1165; Antisense; GTCTTATGGGTGTCATTGGCGCCAC
>probe:Drosophila_2:1631834_at:15:437; Interrogation_Position=1239; Antisense; GAGGATCTGAACTCACGCACTGAGA
>probe:Drosophila_2:1631834_at:336:217; Interrogation_Position=1302; Antisense; AAGTATCGGGCTTTCCTTCAGCGAA
>probe:Drosophila_2:1631834_at:361:285; Interrogation_Position=810; Antisense; CTGGCCGAGAATGTCCTGCAAAGAG
>probe:Drosophila_2:1631834_at:273:171; Interrogation_Position=829; Antisense; AAAGAGCGCTGACCATGTTTGAGAG
>probe:Drosophila_2:1631834_at:691:267; Interrogation_Position=856; Antisense; CAGGCAAGGATTTCCGGGTCTTCAA
>probe:Drosophila_2:1631834_at:278:201; Interrogation_Position=879; Antisense; AACCTCACCGATCTGTGGATCAACA
>probe:Drosophila_2:1631834_at:54:187; Interrogation_Position=900; Antisense; AACAATCTCTTGTTCCACATCAACA
>probe:Drosophila_2:1631834_at:643:493; Interrogation_Position=951; Antisense; GTCACATTGGACTTTCAGTTGGCCT
>probe:Drosophila_2:1631834_at:703:263; Interrogation_Position=966; Antisense; CAGTTGGCCTATGTGGGATCCCCAA
>probe:Drosophila_2:1631834_at:693:5; Interrogation_Position=993; Antisense; ATTGATCTCAATTACTTCCTCTACG

Paste this into a BLAST search page for me
TTCCTCTACGGATCCTTGAACGAGAGAGAATGTTCGTAAGGTCCACTATAGAGTGCTTCAGCAGACCCTGGAGAAGTCTTATGGGTGTCATTGGCGCCACGAGGATCTGAACTCACGCACTGAGAAAGTATCGGGCTTTCCTTCAGCGAACTGGCCGAGAATGTCCTGCAAAGAGAAAGAGCGCTGACCATGTTTGAGAGCAGGCAAGGATTTCCGGGTCTTCAAAACCTCACCGATCTGTGGATCAACAAACAATCTCTTGTTCCACATCAACAGTCACATTGGACTTTCAGTTGGCCTCAGTTGGCCTATGTGGGATCCCCAAATTGATCTCAATTACTTCCTCTACG

Full Affymetrix probeset data:

Annotations for 1631834_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720