FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631835_at:

>probe:Drosophila_2:1631835_at:433:399; Interrogation_Position=1692; Antisense; GACACTGTGTATTCTTTCATTTCGT
>probe:Drosophila_2:1631835_at:623:477; Interrogation_Position=1783; Antisense; GTTTTTATCCTGGTTTCCATTCTAG
>probe:Drosophila_2:1631835_at:233:269; Interrogation_Position=1800; Antisense; CATTCTAGGATTACCTTCCTTTCGG
>probe:Drosophila_2:1631835_at:173:1; Interrogation_Position=1814; Antisense; CTTCCTTTCGGGTGACAACAATTAT
>probe:Drosophila_2:1631835_at:696:473; Interrogation_Position=1895; Antisense; GTTTTAATTTCACACCGACGGCATT
>probe:Drosophila_2:1631835_at:699:3; Interrogation_Position=1917; Antisense; ATTGATGTGTTATTGCCGGGTCTAT
>probe:Drosophila_2:1631835_at:497:637; Interrogation_Position=1970; Antisense; TCGTTTGTGGTTTTTGGCGTTGCTT
>probe:Drosophila_2:1631835_at:241:715; Interrogation_Position=1993; Antisense; TTCTTTCTGGGCTTGGGTTATGTTC
>probe:Drosophila_2:1631835_at:600:629; Interrogation_Position=2016; Antisense; TCCAGGTTTGGATTGCACTACAGAG
>probe:Drosophila_2:1631835_at:340:163; Interrogation_Position=2041; Antisense; AAATTCATGCGATCTTTCCCTACGA
>probe:Drosophila_2:1631835_at:520:367; Interrogation_Position=2064; Antisense; GAATCGAATCGGTCTTACTGGCTAA
>probe:Drosophila_2:1631835_at:686:591; Interrogation_Position=2100; Antisense; TGGTGATCTTTGCTAGGTCTTCTCC
>probe:Drosophila_2:1631835_at:515:543; Interrogation_Position=2131; Antisense; GGATCGTGTCTCATTGGGCTTTTTT
>probe:Drosophila_2:1631835_at:59:349; Interrogation_Position=2188; Antisense; GCATGTCCTGACTTAGCTCTATAAA

Paste this into a BLAST search page for me
GACACTGTGTATTCTTTCATTTCGTGTTTTTATCCTGGTTTCCATTCTAGCATTCTAGGATTACCTTCCTTTCGGCTTCCTTTCGGGTGACAACAATTATGTTTTAATTTCACACCGACGGCATTATTGATGTGTTATTGCCGGGTCTATTCGTTTGTGGTTTTTGGCGTTGCTTTTCTTTCTGGGCTTGGGTTATGTTCTCCAGGTTTGGATTGCACTACAGAGAAATTCATGCGATCTTTCCCTACGAGAATCGAATCGGTCTTACTGGCTAATGGTGATCTTTGCTAGGTCTTCTCCGGATCGTGTCTCATTGGGCTTTTTTGCATGTCCTGACTTAGCTCTATAAA

Full Affymetrix probeset data:

Annotations for 1631835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720