Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631836_at:

>probe:Drosophila_2:1631836_at:404:599; Interrogation_Position=1023; Antisense; TGTCAAGCCATATATCTGCGATAGT
>probe:Drosophila_2:1631836_at:461:351; Interrogation_Position=1124; Antisense; GCACCGTCTGCAAGGCGGGCTTTAA
>probe:Drosophila_2:1631836_at:431:289; Interrogation_Position=1139; Antisense; CGGGCTTTAAGAATCGGGCTCGGCT
>probe:Drosophila_2:1631836_at:158:555; Interrogation_Position=1188; Antisense; GGAGCCCAGTTTCGTGTGCAACATT
>probe:Drosophila_2:1631836_at:444:211; Interrogation_Position=1219; Antisense; AAGAAGCTGCAAACGCGTCGCACCT
>probe:Drosophila_2:1631836_at:495:257; Interrogation_Position=1252; Antisense; CACAAGGTCGTGCACACCGAGGAGC
>probe:Drosophila_2:1631836_at:387:615; Interrogation_Position=1283; Antisense; TGAAGTGTGATGTCTGCGGCGCTCT
>probe:Drosophila_2:1631836_at:656:711; Interrogation_Position=1309; Antisense; TTCAAGCGCTCAAAGACTCTCAAGA
>probe:Drosophila_2:1631836_at:633:571; Interrogation_Position=1355; Antisense; GGCTGCGACCGTACGTTTGCAACTA
>probe:Drosophila_2:1631836_at:375:615; Interrogation_Position=1372; Antisense; TGCAACTACTGTGGCAAGTCCTTTG
>probe:Drosophila_2:1631836_at:517:217; Interrogation_Position=1387; Antisense; AAGTCCTTTGCCTGTAATGCCAATT
>probe:Drosophila_2:1631836_at:143:721; Interrogation_Position=1410; Antisense; TTGCCGGTCGCACAAGCTCAAGAAA
>probe:Drosophila_2:1631836_at:483:633; Interrogation_Position=1479; Antisense; TCGCCTCAATGTTCCAACGTTGGAT
>probe:Drosophila_2:1631836_at:388:19; Interrogation_Position=958; Antisense; ATTTGCAACAAAACGCTATCCTCCG

Paste this into a BLAST search page for me
TGTCAAGCCATATATCTGCGATAGTGCACCGTCTGCAAGGCGGGCTTTAACGGGCTTTAAGAATCGGGCTCGGCTGGAGCCCAGTTTCGTGTGCAACATTAAGAAGCTGCAAACGCGTCGCACCTCACAAGGTCGTGCACACCGAGGAGCTGAAGTGTGATGTCTGCGGCGCTCTTTCAAGCGCTCAAAGACTCTCAAGAGGCTGCGACCGTACGTTTGCAACTATGCAACTACTGTGGCAAGTCCTTTGAAGTCCTTTGCCTGTAATGCCAATTTTGCCGGTCGCACAAGCTCAAGAAATCGCCTCAATGTTCCAACGTTGGATATTTGCAACAAAACGCTATCCTCCG

Full Affymetrix probeset data:

Annotations for 1631836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime