FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631837_at:

>probe:Drosophila_2:1631837_at:422:583; Interrogation_Position=4439; Antisense; TGGCAACGTTGGCTCTGATGATGAT
>probe:Drosophila_2:1631837_at:441:49; Interrogation_Position=4468; Antisense; ATGCCAGCGATGATGATTCGCCCAA
>probe:Drosophila_2:1631837_at:462:319; Interrogation_Position=4487; Antisense; GCCCAAGCGTCCAGCTAAGCGTGGA
>probe:Drosophila_2:1631837_at:334:561; Interrogation_Position=4644; Antisense; GGAACACATTTCCACACAGGATATT
>probe:Drosophila_2:1631837_at:718:365; Interrogation_Position=4688; Antisense; GAATCAGCATTATCCGCATCGAGAA
>probe:Drosophila_2:1631837_at:603:421; Interrogation_Position=4708; Antisense; GAGAATCTCGAGGAGGCACTTTTTT
>probe:Drosophila_2:1631837_at:622:699; Interrogation_Position=4729; Antisense; TTTTTTGCGGACTTGCTCGCCACGA
>probe:Drosophila_2:1631837_at:467:281; Interrogation_Position=4744; Antisense; CTCGCCACGATCGTTCGTTATTTTA
>probe:Drosophila_2:1631837_at:217:655; Interrogation_Position=4769; Antisense; TAATCTTTCAATGTTCTCCTCGATG
>probe:Drosophila_2:1631837_at:563:467; Interrogation_Position=4781; Antisense; GTTCTCCTCGATGTTAACGTCAATG
>probe:Drosophila_2:1631837_at:332:663; Interrogation_Position=4837; Antisense; TAAACACTTCGCTACATTCGTTCAC
>probe:Drosophila_2:1631837_at:514:473; Interrogation_Position=4856; Antisense; GTTCACTGTAGCTGATTCTGTTCCA
>probe:Drosophila_2:1631837_at:91:499; Interrogation_Position=4959; Antisense; GTCTCATACGAGTTTTCTTCATGTA
>probe:Drosophila_2:1631837_at:46:31; Interrogation_Position=4985; Antisense; ATAAATCACTTTTGCCGAATGGCTA

Paste this into a BLAST search page for me
TGGCAACGTTGGCTCTGATGATGATATGCCAGCGATGATGATTCGCCCAAGCCCAAGCGTCCAGCTAAGCGTGGAGGAACACATTTCCACACAGGATATTGAATCAGCATTATCCGCATCGAGAAGAGAATCTCGAGGAGGCACTTTTTTTTTTTTGCGGACTTGCTCGCCACGACTCGCCACGATCGTTCGTTATTTTATAATCTTTCAATGTTCTCCTCGATGGTTCTCCTCGATGTTAACGTCAATGTAAACACTTCGCTACATTCGTTCACGTTCACTGTAGCTGATTCTGTTCCAGTCTCATACGAGTTTTCTTCATGTAATAAATCACTTTTGCCGAATGGCTA

Full Affymetrix probeset data:

Annotations for 1631837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720