Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631843_at:

>probe:Drosophila_2:1631843_at:589:59; Interrogation_Position=1248; Antisense; ATGTTTGCACCAATGCGGCGTCTTC
>probe:Drosophila_2:1631843_at:282:109; Interrogation_Position=1273; Antisense; AGAAGCTCCACTTGGGTCACAATCT
>probe:Drosophila_2:1631843_at:230:77; Interrogation_Position=1303; Antisense; AGGAGATCAACCTCGATGTGCTGGA
>probe:Drosophila_2:1631843_at:432:361; Interrogation_Position=1391; Antisense; GAATGTGAGCTTCCCGAACCTTAAG
>probe:Drosophila_2:1631843_at:404:205; Interrogation_Position=1413; Antisense; AAGCGCGTGGCCATCGAGGGTAATC
>probe:Drosophila_2:1631843_at:583:433; Interrogation_Position=1428; Antisense; GAGGGTAATCCCTGGCAGTGTCCTT
>probe:Drosophila_2:1631843_at:303:511; Interrogation_Position=1458; Antisense; GTGAAGCTGCAACACTGGCTGGCCA
>probe:Drosophila_2:1631843_at:5:83; Interrogation_Position=1485; Antisense; AGGGATGTGGTCTATCTGCGCGATA
>probe:Drosophila_2:1631843_at:275:39; Interrogation_Position=1498; Antisense; ATCTGCGCGATAACACGGGCTACTA
>probe:Drosophila_2:1631843_at:108:413; Interrogation_Position=1534; Antisense; GACCCCTGTGCATAGTGACCAATGT
>probe:Drosophila_2:1631843_at:129:331; Interrogation_Position=1635; Antisense; GCGGATGCTTTCGATGACGATGCCA
>probe:Drosophila_2:1631843_at:717:337; Interrogation_Position=1665; Antisense; GCTCAAGACTGATTGCTACCATTTA
>probe:Drosophila_2:1631843_at:452:183; Interrogation_Position=1743; Antisense; AAAAGATACCACTCTGTGTGCCCTG
>probe:Drosophila_2:1631843_at:456:597; Interrogation_Position=1759; Antisense; TGTGCCCTGGGATTTGCTAGCAAAT

Paste this into a BLAST search page for me
ATGTTTGCACCAATGCGGCGTCTTCAGAAGCTCCACTTGGGTCACAATCTAGGAGATCAACCTCGATGTGCTGGAGAATGTGAGCTTCCCGAACCTTAAGAAGCGCGTGGCCATCGAGGGTAATCGAGGGTAATCCCTGGCAGTGTCCTTGTGAAGCTGCAACACTGGCTGGCCAAGGGATGTGGTCTATCTGCGCGATAATCTGCGCGATAACACGGGCTACTAGACCCCTGTGCATAGTGACCAATGTGCGGATGCTTTCGATGACGATGCCAGCTCAAGACTGATTGCTACCATTTAAAAAGATACCACTCTGTGTGCCCTGTGTGCCCTGGGATTTGCTAGCAAAT

Full Affymetrix probeset data:

Annotations for 1631843_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime