Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631844_at:

>probe:Drosophila_2:1631844_at:428:457; Interrogation_Position=2886; Antisense; GATATTTCCGTTATAGAAACCAAGG
>probe:Drosophila_2:1631844_at:549:391; Interrogation_Position=2901; Antisense; GAAACCAAGGCATTTCTCTTACATT
>probe:Drosophila_2:1631844_at:387:423; Interrogation_Position=2963; Antisense; GAGACAGACATATAAACCTCTTTAT
>probe:Drosophila_2:1631844_at:475:185; Interrogation_Position=2977; Antisense; AACCTCTTTATATACTGGAAACACA
>probe:Drosophila_2:1631844_at:227:381; Interrogation_Position=3005; Antisense; GAACCCAATATATGCAATTTGCTGC
>probe:Drosophila_2:1631844_at:201:361; Interrogation_Position=3036; Antisense; GCAAGATAGAAACTTTTCCCAAGCA
>probe:Drosophila_2:1631844_at:504:475; Interrogation_Position=3254; Antisense; GTTATTGATAGTTCAGGCATCTACG
>probe:Drosophila_2:1631844_at:273:569; Interrogation_Position=3269; Antisense; GGCATCTACGTAATTAAAGCTGGAG
>probe:Drosophila_2:1631844_at:248:427; Interrogation_Position=3291; Antisense; GAGTTGAGTTCTAGAGCTTCAGCGA
>probe:Drosophila_2:1631844_at:642:101; Interrogation_Position=3303; Antisense; AGAGCTTCAGCGATGTCACATGCTA
>probe:Drosophila_2:1631844_at:387:123; Interrogation_Position=3311; Antisense; AGCGATGTCACATGCTATCTGCGAC
>probe:Drosophila_2:1631844_at:563:619; Interrogation_Position=3323; Antisense; TGCTATCTGCGACATGGAAATCCAT
>probe:Drosophila_2:1631844_at:41:561; Interrogation_Position=3338; Antisense; GGAAATCCATCAGTTTTTATTTGTA
>probe:Drosophila_2:1631844_at:540:427; Interrogation_Position=3404; Antisense; GAGTAAATCGAAACCCAACCAGTTG

Paste this into a BLAST search page for me
GATATTTCCGTTATAGAAACCAAGGGAAACCAAGGCATTTCTCTTACATTGAGACAGACATATAAACCTCTTTATAACCTCTTTATATACTGGAAACACAGAACCCAATATATGCAATTTGCTGCGCAAGATAGAAACTTTTCCCAAGCAGTTATTGATAGTTCAGGCATCTACGGGCATCTACGTAATTAAAGCTGGAGGAGTTGAGTTCTAGAGCTTCAGCGAAGAGCTTCAGCGATGTCACATGCTAAGCGATGTCACATGCTATCTGCGACTGCTATCTGCGACATGGAAATCCATGGAAATCCATCAGTTTTTATTTGTAGAGTAAATCGAAACCCAACCAGTTG

Full Affymetrix probeset data:

Annotations for 1631844_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime