Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631846_at:

>probe:Drosophila_2:1631846_at:490:301; Interrogation_Position=1116; Antisense; CCCGTCTGGATTTATTCAGGGCCTA
>probe:Drosophila_2:1631846_at:556:669; Interrogation_Position=1139; Antisense; TACTGCAGAGCCGAGTTGGCCGCAA
>probe:Drosophila_2:1631846_at:540:577; Interrogation_Position=1156; Antisense; GGCCGCAAAGCCACTGCATTTCTGG
>probe:Drosophila_2:1631846_at:634:253; Interrogation_Position=1243; Antisense; CAAAAGAACGTGACCTTGCTGCTGG
>probe:Drosophila_2:1631846_at:312:593; Interrogation_Position=1289; Antisense; TGGGCATCTCTATGTGCTACACGGT
>probe:Drosophila_2:1631846_at:619:335; Interrogation_Position=1355; Antisense; GCTCGCGCGGAATTGCTGCAGTGCA
>probe:Drosophila_2:1631846_at:31:307; Interrogation_Position=1412; Antisense; CCTACCTCATTCATTTGGGCACTAA
>probe:Drosophila_2:1631846_at:630:445; Interrogation_Position=1490; Antisense; GATGCACTCTCATGCTGCCGGAAAC
>probe:Drosophila_2:1631846_at:319:387; Interrogation_Position=1515; Antisense; GAACAATAGACAACTGCCCATCACA
>probe:Drosophila_2:1631846_at:71:151; Interrogation_Position=1537; Antisense; ACATTGGCTGATGGCGAGGCATTTG
>probe:Drosophila_2:1631846_at:544:81; Interrogation_Position=1565; Antisense; AGGGCGAATCCATGCTATCCTTTGA
>probe:Drosophila_2:1631846_at:80:683; Interrogation_Position=1580; Antisense; TATCCTTTGATTGTTGGCGTCGCCA
>probe:Drosophila_2:1631846_at:195:503; Interrogation_Position=1598; Antisense; GTCGCCACGATGACGATGTATCCAA
>probe:Drosophila_2:1631846_at:451:109; Interrogation_Position=1635; Antisense; AGAAGTGAGGCTGCACCAGCTCAAT

Paste this into a BLAST search page for me
CCCGTCTGGATTTATTCAGGGCCTATACTGCAGAGCCGAGTTGGCCGCAAGGCCGCAAAGCCACTGCATTTCTGGCAAAAGAACGTGACCTTGCTGCTGGTGGGCATCTCTATGTGCTACACGGTGCTCGCGCGGAATTGCTGCAGTGCACCTACCTCATTCATTTGGGCACTAAGATGCACTCTCATGCTGCCGGAAACGAACAATAGACAACTGCCCATCACAACATTGGCTGATGGCGAGGCATTTGAGGGCGAATCCATGCTATCCTTTGATATCCTTTGATTGTTGGCGTCGCCAGTCGCCACGATGACGATGTATCCAAAGAAGTGAGGCTGCACCAGCTCAAT

Full Affymetrix probeset data:

Annotations for 1631846_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime