FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631848_at:

>probe:Drosophila_2:1631848_at:345:725; Interrogation_Position=540; Antisense; TTGGGCGCTTCGACTTCCGAGAGAT
>probe:Drosophila_2:1631848_at:9:427; Interrogation_Position=558; Antisense; GAGAGATCTCGTTCCGCTGGAGCTG
>probe:Drosophila_2:1631848_at:198:467; Interrogation_Position=592; Antisense; GTTGGGATCGGAGCACACACTGGAC
>probe:Drosophila_2:1631848_at:26:427; Interrogation_Position=635; Antisense; GAGATGCAGTGCCTTCACACAGATG
>probe:Drosophila_2:1631848_at:583:407; Interrogation_Position=662; Antisense; GACGGTTGCGATGGCTGCTCTTCTA
>probe:Drosophila_2:1631848_at:190:621; Interrogation_Position=677; Antisense; TGCTCTTCTAGCCAGGGTGTCCTAA
>probe:Drosophila_2:1631848_at:528:531; Interrogation_Position=691; Antisense; GGGTGTCCTAATGATTTCCTACATG
>probe:Drosophila_2:1631848_at:525:59; Interrogation_Position=713; Antisense; ATGTTCGATCTGTCCGAGCACAATC
>probe:Drosophila_2:1631848_at:545:421; Interrogation_Position=728; Antisense; GAGCACAATCCGTTTCTCGATGTCC
>probe:Drosophila_2:1631848_at:675:479; Interrogation_Position=808; Antisense; GTTTCCACTTAGCTACCTCATGTCA
>probe:Drosophila_2:1631848_at:414:257; Interrogation_Position=831; Antisense; CACCGTTCTACGACAAGTTCTACAG
>probe:Drosophila_2:1631848_at:81:433; Interrogation_Position=899; Antisense; GAGTGGCTAATATATCCCGAGTCCT
>probe:Drosophila_2:1631848_at:724:197; Interrogation_Position=947; Antisense; AACGAGTTCCGCCAGCTGAGGGATA
>probe:Drosophila_2:1631848_at:426:517; Interrogation_Position=975; Antisense; GTGGTTCAAGGATAGCGCGCAATGC

Paste this into a BLAST search page for me
TTGGGCGCTTCGACTTCCGAGAGATGAGAGATCTCGTTCCGCTGGAGCTGGTTGGGATCGGAGCACACACTGGACGAGATGCAGTGCCTTCACACAGATGGACGGTTGCGATGGCTGCTCTTCTATGCTCTTCTAGCCAGGGTGTCCTAAGGGTGTCCTAATGATTTCCTACATGATGTTCGATCTGTCCGAGCACAATCGAGCACAATCCGTTTCTCGATGTCCGTTTCCACTTAGCTACCTCATGTCACACCGTTCTACGACAAGTTCTACAGGAGTGGCTAATATATCCCGAGTCCTAACGAGTTCCGCCAGCTGAGGGATAGTGGTTCAAGGATAGCGCGCAATGC

Full Affymetrix probeset data:

Annotations for 1631848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720