Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631849_at:

>probe:Drosophila_2:1631849_at:632:689; Interrogation_Position=2593; Antisense; TATTATATACACGAACACGAGCATA
>probe:Drosophila_2:1631849_at:115:39; Interrogation_Position=2639; Antisense; ATCTAGATCATGTAAGCCCAGTGTC
>probe:Drosophila_2:1631849_at:558:57; Interrogation_Position=2648; Antisense; ATGTAAGCCCAGTGTCTAGCGGCAG
>probe:Drosophila_2:1631849_at:374:279; Interrogation_Position=2663; Antisense; CTAGCGGCAGGCTCAGAGTGAGAAT
>probe:Drosophila_2:1631849_at:325:29; Interrogation_Position=2759; Antisense; ATACGTATGTAGATGTCGAGGCGAA
>probe:Drosophila_2:1631849_at:524:371; Interrogation_Position=2781; Antisense; GAAGGAGCAACAATTGTTTTCCATT
>probe:Drosophila_2:1631849_at:337:477; Interrogation_Position=2796; Antisense; GTTTTCCATTAACAATAGCGTATGC
>probe:Drosophila_2:1631849_at:169:551; Interrogation_Position=2856; Antisense; GGAGAAAGCCAAAACCCATTCGCAT
>probe:Drosophila_2:1631849_at:139:313; Interrogation_Position=2863; Antisense; GCCAAAACCCATTCGCATTATACAT
>probe:Drosophila_2:1631849_at:264:515; Interrogation_Position=2899; Antisense; GTGTAACTGAACATTTGTGTGGCAA
>probe:Drosophila_2:1631849_at:409:517; Interrogation_Position=2915; Antisense; GTGTGGCAATATTTATTTGTACGCT
>probe:Drosophila_2:1631849_at:439:713; Interrogation_Position=2953; Antisense; TTCATTCATTCTTTTGTATATCGCA
>probe:Drosophila_2:1631849_at:295:105; Interrogation_Position=2981; Antisense; AGAAATGCTTCTGTTGGAATCGCTC
>probe:Drosophila_2:1631849_at:255:565; Interrogation_Position=2996; Antisense; GGAATCGCTCAGTAACCGAGTGGAA

Paste this into a BLAST search page for me
TATTATATACACGAACACGAGCATAATCTAGATCATGTAAGCCCAGTGTCATGTAAGCCCAGTGTCTAGCGGCAGCTAGCGGCAGGCTCAGAGTGAGAATATACGTATGTAGATGTCGAGGCGAAGAAGGAGCAACAATTGTTTTCCATTGTTTTCCATTAACAATAGCGTATGCGGAGAAAGCCAAAACCCATTCGCATGCCAAAACCCATTCGCATTATACATGTGTAACTGAACATTTGTGTGGCAAGTGTGGCAATATTTATTTGTACGCTTTCATTCATTCTTTTGTATATCGCAAGAAATGCTTCTGTTGGAATCGCTCGGAATCGCTCAGTAACCGAGTGGAA

Full Affymetrix probeset data:

Annotations for 1631849_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime