FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631851_at:

>probe:Drosophila_2:1631851_at:695:67; Interrogation_Position=13; Antisense; ATGGCCATGTATCCCACACAGCAGC
>probe:Drosophila_2:1631851_at:114:115; Interrogation_Position=176; Antisense; AGCAGCATTCACACAACCAGCATCA
>probe:Drosophila_2:1631851_at:33:117; Interrogation_Position=179; Antisense; AGCATTCACACAACCAGCATCAGCA
>probe:Drosophila_2:1631851_at:56:115; Interrogation_Position=206; Antisense; AGCAGCACTATATCCACCAACTGTA
>probe:Drosophila_2:1631851_at:388:687; Interrogation_Position=214; Antisense; TATATCCACCAACTGTACTATCCAT
>probe:Drosophila_2:1631851_at:568:195; Interrogation_Position=224; Antisense; AACTGTACTATCCATCGCACTGGGT
>probe:Drosophila_2:1631851_at:146:49; Interrogation_Position=233; Antisense; ATCCATCGCACTGGGTGCAGCAGCA
>probe:Drosophila_2:1631851_at:518:351; Interrogation_Position=267; Antisense; GCAGCAGCAGGTAGCAAACAACGAG
>probe:Drosophila_2:1631851_at:68:113; Interrogation_Position=311; Antisense; AGCAACAACCACCAGTGGCTCAGGT
>probe:Drosophila_2:1631851_at:87:129; Interrogation_Position=318; Antisense; ACCACCAGTGGCTCAGGTTTATGGC
>probe:Drosophila_2:1631851_at:660:571; Interrogation_Position=327; Antisense; GGCTCAGGTTTATGGCATGTCCGAA
>probe:Drosophila_2:1631851_at:124:77; Interrogation_Position=332; Antisense; AGGTTTATGGCATGTCCGAAGTGTA
>probe:Drosophila_2:1631851_at:590:189; Interrogation_Position=86; Antisense; AACATGAGCAGCAGACGTCCGGCGA
>probe:Drosophila_2:1631851_at:97:115; Interrogation_Position=92; Antisense; AGCAGCAGACGTCCGGCGAATATGT

Paste this into a BLAST search page for me
ATGGCCATGTATCCCACACAGCAGCAGCAGCATTCACACAACCAGCATCAAGCATTCACACAACCAGCATCAGCAAGCAGCACTATATCCACCAACTGTATATATCCACCAACTGTACTATCCATAACTGTACTATCCATCGCACTGGGTATCCATCGCACTGGGTGCAGCAGCAGCAGCAGCAGGTAGCAAACAACGAGAGCAACAACCACCAGTGGCTCAGGTACCACCAGTGGCTCAGGTTTATGGCGGCTCAGGTTTATGGCATGTCCGAAAGGTTTATGGCATGTCCGAAGTGTAAACATGAGCAGCAGACGTCCGGCGAAGCAGCAGACGTCCGGCGAATATGT

Full Affymetrix probeset data:

Annotations for 1631851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720