FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631853_at:

>probe:Drosophila_2:1631853_at:267:269; Interrogation_Position=120; Antisense; CATCTCTACCCTAATGCCATTGGAA
>probe:Drosophila_2:1631853_at:70:587; Interrogation_Position=149; Antisense; TGGACAAATGCATCGGTTCCCGCAT
>probe:Drosophila_2:1631853_at:28:597; Interrogation_Position=15; Antisense; TGTTTACCTCGCTGCTAAAAAGTTT
>probe:Drosophila_2:1631853_at:11:721; Interrogation_Position=165; Antisense; TTCCCGCATCCACATTATCATGAAG
>probe:Drosophila_2:1631853_at:33:443; Interrogation_Position=201; Antisense; GATGGTGGGAACTCTCTTAGGATTC
>probe:Drosophila_2:1631853_at:688:279; Interrogation_Position=214; Antisense; CTCTTAGGATTCGATGACTTTGTGA
>probe:Drosophila_2:1631853_at:676:403; Interrogation_Position=229; Antisense; GACTTTGTGAATATGCTCTTGGACG
>probe:Drosophila_2:1631853_at:419:241; Interrogation_Position=238; Antisense; AATATGCTCTTGGACGACGTAACGG
>probe:Drosophila_2:1631853_at:440:299; Interrogation_Position=286; Antisense; CGCCGCATCACCAAACTGGATCAGA
>probe:Drosophila_2:1631853_at:179:453; Interrogation_Position=304; Antisense; GATCAGATTCTGCTCAACGGGAACA
>probe:Drosophila_2:1631853_at:585:619; Interrogation_Position=314; Antisense; TGCTCAACGGGAACAATATCACAAT
>probe:Drosophila_2:1631853_at:69:35; Interrogation_Position=331; Antisense; ATCACAATGTTGGTGCCTGGCGGAG
>probe:Drosophila_2:1631853_at:516:211; Interrogation_Position=34; Antisense; AAGTTTTTAGCGCAATTCCAATTAT
>probe:Drosophila_2:1631853_at:610:331; Interrogation_Position=357; Antisense; GCTGGCGGAGTAGCAAGGTTCCATT

Paste this into a BLAST search page for me
CATCTCTACCCTAATGCCATTGGAATGGACAAATGCATCGGTTCCCGCATTGTTTACCTCGCTGCTAAAAAGTTTTTCCCGCATCCACATTATCATGAAGGATGGTGGGAACTCTCTTAGGATTCCTCTTAGGATTCGATGACTTTGTGAGACTTTGTGAATATGCTCTTGGACGAATATGCTCTTGGACGACGTAACGGCGCCGCATCACCAAACTGGATCAGAGATCAGATTCTGCTCAACGGGAACATGCTCAACGGGAACAATATCACAATATCACAATGTTGGTGCCTGGCGGAGAAGTTTTTAGCGCAATTCCAATTATGCTGGCGGAGTAGCAAGGTTCCATT

Full Affymetrix probeset data:

Annotations for 1631853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720