FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631857_at:

>probe:Drosophila_2:1631857_at:261:277; Interrogation_Position=1041; Antisense; CTACAATAATGTTACCCTCGTCGCT
>probe:Drosophila_2:1631857_at:696:639; Interrogation_Position=1080; Antisense; TCGGAGCCCCGAGGTGCAGAATAGA
>probe:Drosophila_2:1631857_at:241:81; Interrogation_Position=534; Antisense; AGGTGTGCCACTGCCGCACGTAATG
>probe:Drosophila_2:1631857_at:278:331; Interrogation_Position=577; Antisense; GCGGATCACACGAATCTGGCGGACA
>probe:Drosophila_2:1631857_at:265:583; Interrogation_Position=593; Antisense; TGGCGGACATGGGACTGACCAATCT
>probe:Drosophila_2:1631857_at:730:323; Interrogation_Position=622; Antisense; GCGCTAACCAGTTCCGAGATCGAGG
>probe:Drosophila_2:1631857_at:287:133; Interrogation_Position=663; Antisense; ACCCAAGCGATCCTTCACGATAGAG
>probe:Drosophila_2:1631857_at:105:457; Interrogation_Position=681; Antisense; GATAGAGAGCCTGATCACGCCCGAC
>probe:Drosophila_2:1631857_at:188:155; Interrogation_Position=704; Antisense; ACAAGCCGGAACATCCGTCGGAGGA
>probe:Drosophila_2:1631857_at:704:77; Interrogation_Position=740; Antisense; AGGATGACCGCGTCGATATCGATGT
>probe:Drosophila_2:1631857_at:159:433; Interrogation_Position=769; Antisense; GAGTGCAGCGGTATCAGCCGCTATC
>probe:Drosophila_2:1631857_at:452:437; Interrogation_Position=814; Antisense; GAGGAGTATATGTCCGCCAGCCGAT
>probe:Drosophila_2:1631857_at:138:451; Interrogation_Position=836; Antisense; GATCGAGCCGAACGGAGGATCCCCT
>probe:Drosophila_2:1631857_at:448:641; Interrogation_Position=903; Antisense; TCTGCACTATGCCACGGGTGCCAAT

Paste this into a BLAST search page for me
CTACAATAATGTTACCCTCGTCGCTTCGGAGCCCCGAGGTGCAGAATAGAAGGTGTGCCACTGCCGCACGTAATGGCGGATCACACGAATCTGGCGGACATGGCGGACATGGGACTGACCAATCTGCGCTAACCAGTTCCGAGATCGAGGACCCAAGCGATCCTTCACGATAGAGGATAGAGAGCCTGATCACGCCCGACACAAGCCGGAACATCCGTCGGAGGAAGGATGACCGCGTCGATATCGATGTGAGTGCAGCGGTATCAGCCGCTATCGAGGAGTATATGTCCGCCAGCCGATGATCGAGCCGAACGGAGGATCCCCTTCTGCACTATGCCACGGGTGCCAAT

Full Affymetrix probeset data:

Annotations for 1631857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720