FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631860_at:

>probe:Drosophila_2:1631860_at:455:669; Interrogation_Position=125; Antisense; TACTGACCTACGTTCTCGAGCTGGA
>probe:Drosophila_2:1631860_at:227:483; Interrogation_Position=152; Antisense; GTATCTACCATATTCGTCCGGAGCA
>probe:Drosophila_2:1631860_at:450:629; Interrogation_Position=265; Antisense; TCCGGCTACATCTTTATTCGACAGG
>probe:Drosophila_2:1631860_at:317:277; Interrogation_Position=307; Antisense; CTATGGCTAGCCTTGTATGCGGGCA
>probe:Drosophila_2:1631860_at:468:683; Interrogation_Position=322; Antisense; TATGCGGGCATCCACAAGATCCTGT
>probe:Drosophila_2:1631860_at:603:11; Interrogation_Position=366; Antisense; ATTCGTGATCCTCATGTGCCGCAAG
>probe:Drosophila_2:1631860_at:263:345; Interrogation_Position=398; Antisense; GCATTGCCTACGATTTCTGCACATT
>probe:Drosophila_2:1631860_at:648:717; Interrogation_Position=431; Antisense; TTCGCCCTTTGGCAAGAATCTCATT
>probe:Drosophila_2:1631860_at:295:239; Interrogation_Position=447; Antisense; AATCTCATTTCAGTCGTTTCTCTGG
>probe:Drosophila_2:1631860_at:598:281; Interrogation_Position=466; Antisense; CTCTGGCACATTGTCGTCCTAAGAA
>probe:Drosophila_2:1631860_at:186:329; Interrogation_Position=557; Antisense; GCGTGTTCATACTCACTCAATTCGT
>probe:Drosophila_2:1631860_at:222:575; Interrogation_Position=594; Antisense; GGCGGTGCTGCTAGAATATCCTTTT
>probe:Drosophila_2:1631860_at:155:137; Interrogation_Position=630; Antisense; ACGATGCCTGATAAAGCCCGAGAAA
>probe:Drosophila_2:1631860_at:472:193; Interrogation_Position=90; Antisense; AACTCTTTTAGCACTTGCCTTTGCA

Paste this into a BLAST search page for me
TACTGACCTACGTTCTCGAGCTGGAGTATCTACCATATTCGTCCGGAGCATCCGGCTACATCTTTATTCGACAGGCTATGGCTAGCCTTGTATGCGGGCATATGCGGGCATCCACAAGATCCTGTATTCGTGATCCTCATGTGCCGCAAGGCATTGCCTACGATTTCTGCACATTTTCGCCCTTTGGCAAGAATCTCATTAATCTCATTTCAGTCGTTTCTCTGGCTCTGGCACATTGTCGTCCTAAGAAGCGTGTTCATACTCACTCAATTCGTGGCGGTGCTGCTAGAATATCCTTTTACGATGCCTGATAAAGCCCGAGAAAAACTCTTTTAGCACTTGCCTTTGCA

Full Affymetrix probeset data:

Annotations for 1631860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720