FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631861_at:

>probe:Drosophila_2:1631861_at:643:87; Interrogation_Position=527; Antisense; AGTCGCCGACTTTGGACTTGGCCGA
>probe:Drosophila_2:1631861_at:653:727; Interrogation_Position=556; Antisense; TTGGCATTCCGGTGCGCATTTATAC
>probe:Drosophila_2:1631861_at:458:683; Interrogation_Position=576; Antisense; TATACGCACGAGATTGTTACCTTGT
>probe:Drosophila_2:1631861_at:583:705; Interrogation_Position=592; Antisense; TTACCTTGTGGTACAGAGCGCCGGA
>probe:Drosophila_2:1631861_at:186:599; Interrogation_Position=645; Antisense; TGTCCCGTCGATATCTGGTCCATTG
>probe:Drosophila_2:1631861_at:186:591; Interrogation_Position=660; Antisense; TGGTCCATTGGATGCATATTCGCGG
>probe:Drosophila_2:1631861_at:194:107; Interrogation_Position=696; Antisense; AGAAAGCCGCTATTCCAGGGTGACT
>probe:Drosophila_2:1631861_at:446:671; Interrogation_Position=767; Antisense; TACCGAAGACATTTGGCCGGGCGTT
>probe:Drosophila_2:1631861_at:647:473; Interrogation_Position=789; Antisense; GTTACTTCGCTACCCGACTATAAGA
>probe:Drosophila_2:1631861_at:293:687; Interrogation_Position=807; Antisense; TATAAGAACACGTTCCCCTGCTGGT
>probe:Drosophila_2:1631861_at:499:633; Interrogation_Position=920; Antisense; TCGCATTTCCGCCAAGGACATTTTG
>probe:Drosophila_2:1631861_at:10:729; Interrogation_Position=942; Antisense; TTGGAGCATCCCTATTTCAATGGTT
>probe:Drosophila_2:1631861_at:473:653; Interrogation_Position=958; Antisense; TCAATGGTTTTCAATCGGGCTTAGT
>probe:Drosophila_2:1631861_at:236:645; Interrogation_Position=990; Antisense; TAACGTTCGGTATTCTCGTTTGACT

Paste this into a BLAST search page for me
AGTCGCCGACTTTGGACTTGGCCGATTGGCATTCCGGTGCGCATTTATACTATACGCACGAGATTGTTACCTTGTTTACCTTGTGGTACAGAGCGCCGGATGTCCCGTCGATATCTGGTCCATTGTGGTCCATTGGATGCATATTCGCGGAGAAAGCCGCTATTCCAGGGTGACTTACCGAAGACATTTGGCCGGGCGTTGTTACTTCGCTACCCGACTATAAGATATAAGAACACGTTCCCCTGCTGGTTCGCATTTCCGCCAAGGACATTTTGTTGGAGCATCCCTATTTCAATGGTTTCAATGGTTTTCAATCGGGCTTAGTTAACGTTCGGTATTCTCGTTTGACT

Full Affymetrix probeset data:

Annotations for 1631861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720