FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631862_at:

>probe:Drosophila_2:1631862_at:144:159; Interrogation_Position=106; Antisense; AAAACGACCCTGGACTACACTCTGA
>probe:Drosophila_2:1631862_at:647:61; Interrogation_Position=13; Antisense; ATGTCCGCCGAAGTGGAGGAACTAT
>probe:Drosophila_2:1631862_at:256:145; Interrogation_Position=137; Antisense; ACTACGCGGCACTGATGCAAACGGT
>probe:Drosophila_2:1631862_at:606:545; Interrogation_Position=189; Antisense; GGATCTGGACGCCACCAACGAATTC
>probe:Drosophila_2:1631862_at:542:253; Interrogation_Position=204; Antisense; CAACGAATTCACCTTCCTGCGGCTG
>probe:Drosophila_2:1631862_at:105:307; Interrogation_Position=219; Antisense; CCTGCGGCTGCGGACTGAGCAGAAT
>probe:Drosophila_2:1631862_at:585:109; Interrogation_Position=239; Antisense; AGAATGAGGTGATGCTGTGCCCGCA
>probe:Drosophila_2:1631862_at:161:287; Interrogation_Position=253; Antisense; CTGTGCCCGCAGGAAGATTACTTCA
>probe:Drosophila_2:1631862_at:167:459; Interrogation_Position=268; Antisense; GATTACTTCATCATGGTGATCCAGA
>probe:Drosophila_2:1631862_at:1:593; Interrogation_Position=281; Antisense; TGGTGATCCAGAGCCCGTGCGACTA
>probe:Drosophila_2:1631862_at:355:3; Interrogation_Position=36; Antisense; ATTGAAGCGCTTTCAGTCCATGAAG
>probe:Drosophila_2:1631862_at:214:505; Interrogation_Position=51; Antisense; GTCCATGAAGAACGTCACCGGCATA
>probe:Drosophila_2:1631862_at:456:589; Interrogation_Position=80; Antisense; TGGTGGACAACGACGGCATTCCGAT
>probe:Drosophila_2:1631862_at:44:571; Interrogation_Position=94; Antisense; GGCATTCCGATCAAAACGACCCTGG

Paste this into a BLAST search page for me
AAAACGACCCTGGACTACACTCTGAATGTCCGCCGAAGTGGAGGAACTATACTACGCGGCACTGATGCAAACGGTGGATCTGGACGCCACCAACGAATTCCAACGAATTCACCTTCCTGCGGCTGCCTGCGGCTGCGGACTGAGCAGAATAGAATGAGGTGATGCTGTGCCCGCACTGTGCCCGCAGGAAGATTACTTCAGATTACTTCATCATGGTGATCCAGATGGTGATCCAGAGCCCGTGCGACTAATTGAAGCGCTTTCAGTCCATGAAGGTCCATGAAGAACGTCACCGGCATATGGTGGACAACGACGGCATTCCGATGGCATTCCGATCAAAACGACCCTGG

Full Affymetrix probeset data:

Annotations for 1631862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720