FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631863_at:

>probe:Drosophila_2:1631863_at:181:215; Interrogation_Position=2437; Antisense; AAGATCGACGACTCCTGCTTAAGAT
>probe:Drosophila_2:1631863_at:417:341; Interrogation_Position=2453; Antisense; GCTTAAGATGGCAGCCCTTCATCAA
>probe:Drosophila_2:1631863_at:56:713; Interrogation_Position=2470; Antisense; TTCATCAATATCCAGCCGAGCTCAT
>probe:Drosophila_2:1631863_at:307:419; Interrogation_Position=2487; Antisense; GAGCTCATCTCCATAACCACGTGGT
>probe:Drosophila_2:1631863_at:298:203; Interrogation_Position=2501; Antisense; AACCACGTGGTTGGAAGCATGCCAG
>probe:Drosophila_2:1631863_at:454:49; Interrogation_Position=2519; Antisense; ATGCCAGGGCATGCTTTGCAGACGC
>probe:Drosophila_2:1631863_at:560:49; Interrogation_Position=2529; Antisense; ATGCTTTGCAGACGCCGACGACGAT
>probe:Drosophila_2:1631863_at:305:409; Interrogation_Position=2548; Antisense; GACGATGACGAATTCTTGGCTCCGA
>probe:Drosophila_2:1631863_at:223:571; Interrogation_Position=2565; Antisense; GGCTCCGAATTCTTGATTTCAACGA
>probe:Drosophila_2:1631863_at:392:39; Interrogation_Position=2608; Antisense; ATCTGAAGAACCACATCTCCAGTCC
>probe:Drosophila_2:1631863_at:257:87; Interrogation_Position=2628; Antisense; AGTCCTTCCTTTGCATTTATCCTAG
>probe:Drosophila_2:1631863_at:529:465; Interrogation_Position=2758; Antisense; GTTGGTAGATCTTAAGGCCAGCCTA
>probe:Drosophila_2:1631863_at:339:227; Interrogation_Position=2771; Antisense; AAGGCCAGCCTATTGTAAACATATG
>probe:Drosophila_2:1631863_at:161:141; Interrogation_Position=2797; Antisense; ACGTGTGTGTGTCTGTACTTGTTAT

Paste this into a BLAST search page for me
AAGATCGACGACTCCTGCTTAAGATGCTTAAGATGGCAGCCCTTCATCAATTCATCAATATCCAGCCGAGCTCATGAGCTCATCTCCATAACCACGTGGTAACCACGTGGTTGGAAGCATGCCAGATGCCAGGGCATGCTTTGCAGACGCATGCTTTGCAGACGCCGACGACGATGACGATGACGAATTCTTGGCTCCGAGGCTCCGAATTCTTGATTTCAACGAATCTGAAGAACCACATCTCCAGTCCAGTCCTTCCTTTGCATTTATCCTAGGTTGGTAGATCTTAAGGCCAGCCTAAAGGCCAGCCTATTGTAAACATATGACGTGTGTGTGTCTGTACTTGTTAT

Full Affymetrix probeset data:

Annotations for 1631863_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720