FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631864_at:

>probe:Drosophila_2:1631864_at:550:569; Interrogation_Position=104; Antisense; GGCTTTCCCGCACCAAAATCGAGAT
>probe:Drosophila_2:1631864_at:531:425; Interrogation_Position=124; Antisense; GAGATCACGGACGAGCTCATATCCA
>probe:Drosophila_2:1631864_at:363:419; Interrogation_Position=136; Antisense; GAGCTCATATCCAATACGGTGCGCA
>probe:Drosophila_2:1631864_at:310:139; Interrogation_Position=151; Antisense; ACGGTGCGCAATCTGAAGACGTGCA
>probe:Drosophila_2:1631864_at:282:103; Interrogation_Position=167; Antisense; AGACGTGCAGCTTGGACGACCTGAA
>probe:Drosophila_2:1631864_at:227:537; Interrogation_Position=195; Antisense; GGTCAACCGGGAGCTACTGTTCAAG
>probe:Drosophila_2:1631864_at:594:141; Interrogation_Position=210; Antisense; ACTGTTCAAGCGGAAACTGCGGAGC
>probe:Drosophila_2:1631864_at:291:195; Interrogation_Position=224; Antisense; AACTGCGGAGCAACGTGTCCAAGCT
>probe:Drosophila_2:1631864_at:309:183; Interrogation_Position=23; Antisense; AAAAGATGCTGAAGCCCACTGTCAC
>probe:Drosophila_2:1631864_at:196:353; Interrogation_Position=267; Antisense; GCAGCAGCGCCAAGAGAACCAAGAC
>probe:Drosophila_2:1631864_at:72:381; Interrogation_Position=282; Antisense; GAACCAAGACAACTCAGCGAAACAG
>probe:Drosophila_2:1631864_at:504:599; Interrogation_Position=42; Antisense; TGTCACCTATCATCTGTTCCTGTAC
>probe:Drosophila_2:1631864_at:253:471; Interrogation_Position=57; Antisense; GTTCCTGTACCGTGTCGAGTTGGCC
>probe:Drosophila_2:1631864_at:376:563; Interrogation_Position=86; Antisense; GGAATGCCCGGCAGCTGCGGCTTTC

Paste this into a BLAST search page for me
GGCTTTCCCGCACCAAAATCGAGATGAGATCACGGACGAGCTCATATCCAGAGCTCATATCCAATACGGTGCGCAACGGTGCGCAATCTGAAGACGTGCAAGACGTGCAGCTTGGACGACCTGAAGGTCAACCGGGAGCTACTGTTCAAGACTGTTCAAGCGGAAACTGCGGAGCAACTGCGGAGCAACGTGTCCAAGCTAAAAGATGCTGAAGCCCACTGTCACGCAGCAGCGCCAAGAGAACCAAGACGAACCAAGACAACTCAGCGAAACAGTGTCACCTATCATCTGTTCCTGTACGTTCCTGTACCGTGTCGAGTTGGCCGGAATGCCCGGCAGCTGCGGCTTTC

Full Affymetrix probeset data:

Annotations for 1631864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720