FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631865_at:

>probe:Drosophila_2:1631865_at:122:291; Interrogation_Position=105; Antisense; CGGTTGCATCAACGCCCCAGGAGTT
>probe:Drosophila_2:1631865_at:62:77; Interrogation_Position=123; Antisense; AGGAGTTGGCTCAGCATCCTGGCTA
>probe:Drosophila_2:1631865_at:101:17; Interrogation_Position=13; Antisense; ATTTTAGCTCGTCGTGCTATTCGGC
>probe:Drosophila_2:1631865_at:321:345; Interrogation_Position=136; Antisense; GCATCCTGGCTACACCATTGTGGCA
>probe:Drosophila_2:1631865_at:276:5; Interrogation_Position=152; Antisense; ATTGTGGCACCTCTCACGAAGATTG
>probe:Drosophila_2:1631865_at:645:215; Interrogation_Position=170; Antisense; AAGATTGCCCACGTCACCTACGATT
>probe:Drosophila_2:1631865_at:438:293; Interrogation_Position=190; Antisense; CGATTCGGTGCCCATTTCGCACACG
>probe:Drosophila_2:1631865_at:232:719; Interrogation_Position=205; Antisense; TTCGCACACGCCCTACGAACATGTT
>probe:Drosophila_2:1631865_at:299:671; Interrogation_Position=218; Antisense; TACGAACATGTTCCTCTCTTCCAGA
>probe:Drosophila_2:1631865_at:14:645; Interrogation_Position=232; Antisense; TCTCTTCCAGAGGATTGGTCATGTC
>probe:Drosophila_2:1631865_at:248:689; Interrogation_Position=30; Antisense; TATTCGGCCTTTTGAGTGGTGCCTT
>probe:Drosophila_2:1631865_at:415:139; Interrogation_Position=62; Antisense; ACGGTTATCTACCATCACCCGGTGA
>probe:Drosophila_2:1631865_at:340:271; Interrogation_Position=74; Antisense; CATCACCCGGTGATCTATCATCATC
>probe:Drosophila_2:1631865_at:372:685; Interrogation_Position=89; Antisense; TATCATCATCCTCTGCCGGTTGCAT

Paste this into a BLAST search page for me
CGGTTGCATCAACGCCCCAGGAGTTAGGAGTTGGCTCAGCATCCTGGCTAATTTTAGCTCGTCGTGCTATTCGGCGCATCCTGGCTACACCATTGTGGCAATTGTGGCACCTCTCACGAAGATTGAAGATTGCCCACGTCACCTACGATTCGATTCGGTGCCCATTTCGCACACGTTCGCACACGCCCTACGAACATGTTTACGAACATGTTCCTCTCTTCCAGATCTCTTCCAGAGGATTGGTCATGTCTATTCGGCCTTTTGAGTGGTGCCTTACGGTTATCTACCATCACCCGGTGACATCACCCGGTGATCTATCATCATCTATCATCATCCTCTGCCGGTTGCAT

Full Affymetrix probeset data:

Annotations for 1631865_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720