Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631866_at:

>probe:Drosophila_2:1631866_at:362:21; Interrogation_Position=3098; Antisense; ATATTTCAGTGGTATCTCGGTTAAT
>probe:Drosophila_2:1631866_at:493:399; Interrogation_Position=3309; Antisense; GACAGGTGGCTTTCTAGACACACTT
>probe:Drosophila_2:1631866_at:645:397; Interrogation_Position=3325; Antisense; GACACACTTTCTTGGAATCCACTAC
>probe:Drosophila_2:1631866_at:368:585; Interrogation_Position=3337; Antisense; TGGAATCCACTACCCAGATCTTTCT
>probe:Drosophila_2:1631866_at:107:97; Interrogation_Position=3352; Antisense; AGATCTTTCTCTTACCGCTGGTAAC
>probe:Drosophila_2:1631866_at:434:15; Interrogation_Position=3382; Antisense; ATTATAGTTTGGCTCCACTCTGTGC
>probe:Drosophila_2:1631866_at:353:695; Interrogation_Position=3413; Antisense; TTTCGCTGCGAGTGAACCGTTCATG
>probe:Drosophila_2:1631866_at:200:403; Interrogation_Position=3440; Antisense; GACGATCCCAAAGAGGAGCCCGGAA
>probe:Drosophila_2:1631866_at:596:559; Interrogation_Position=3461; Antisense; GGAAAGCCGCTTGGCTAACCTGTTA
>probe:Drosophila_2:1631866_at:503:571; Interrogation_Position=3473; Antisense; GGCTAACCTGTTACCATGGCTATAA
>probe:Drosophila_2:1631866_at:612:239; Interrogation_Position=3502; Antisense; AATAACAAAATCACCGCGACCACGG
>probe:Drosophila_2:1631866_at:531:175; Interrogation_Position=3534; Antisense; AAACCGGTGGAGACGATCGCGCATT
>probe:Drosophila_2:1631866_at:469:353; Interrogation_Position=3563; Antisense; GCAGCCTCGGCTTTATAATCGGAAT
>probe:Drosophila_2:1631866_at:240:245; Interrogation_Position=3585; Antisense; AATTCCGACTTCAGTCTCCGATTAG

Paste this into a BLAST search page for me
ATATTTCAGTGGTATCTCGGTTAATGACAGGTGGCTTTCTAGACACACTTGACACACTTTCTTGGAATCCACTACTGGAATCCACTACCCAGATCTTTCTAGATCTTTCTCTTACCGCTGGTAACATTATAGTTTGGCTCCACTCTGTGCTTTCGCTGCGAGTGAACCGTTCATGGACGATCCCAAAGAGGAGCCCGGAAGGAAAGCCGCTTGGCTAACCTGTTAGGCTAACCTGTTACCATGGCTATAAAATAACAAAATCACCGCGACCACGGAAACCGGTGGAGACGATCGCGCATTGCAGCCTCGGCTTTATAATCGGAATAATTCCGACTTCAGTCTCCGATTAG

Full Affymetrix probeset data:

Annotations for 1631866_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime