FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631867_at:

>probe:Drosophila_2:1631867_at:650:683; Interrogation_Position=1019; Antisense; TATCCACCAATTCCGGCGGCAAATG
>probe:Drosophila_2:1631867_at:163:617; Interrogation_Position=1048; Antisense; TGCACCGCCGGGAAGGCAAACTGTT
>probe:Drosophila_2:1631867_at:635:195; Interrogation_Position=1066; Antisense; AACTGTTACGCCAGGATTGCTTAGC
>probe:Drosophila_2:1631867_at:248:465; Interrogation_Position=1080; Antisense; GATTGCTTAGCTGGCCGGAGATTTG
>probe:Drosophila_2:1631867_at:45:429; Interrogation_Position=1097; Antisense; GAGATTTGTGATTTGCTGCAGCAGC
>probe:Drosophila_2:1631867_at:31:115; Interrogation_Position=1116; Antisense; AGCAGCAACCACAGGATCGCGAGGT
>probe:Drosophila_2:1631867_at:690:433; Interrogation_Position=1136; Antisense; GAGGTTCCCCATCTGCGCAAAGTGG
>probe:Drosophila_2:1631867_at:618:169; Interrogation_Position=1154; Antisense; AAAGTGGGCGATCCCACCAAGCGTT
>probe:Drosophila_2:1631867_at:561:691; Interrogation_Position=1178; Antisense; TTTGGCATCTATGCGTACCGGGCAG
>probe:Drosophila_2:1631867_at:42:79; Interrogation_Position=1242; Antisense; AGGATCCCTTGACGGCGGCCATTAA
>probe:Drosophila_2:1631867_at:715:709; Interrogation_Position=1263; Antisense; TTAAGGCCGGATTTGTGCATGCCCA
>probe:Drosophila_2:1631867_at:203:163; Interrogation_Position=1355; Antisense; AAATTTCCCATTCTGCGAAGCATCA
>probe:Drosophila_2:1631867_at:65:343; Interrogation_Position=1431; Antisense; GCTTTCACAATTATCCTTCTACTTT
>probe:Drosophila_2:1631867_at:283:563; Interrogation_Position=987; Antisense; GGAATATGACCCGAAACTCCGGCAT

Paste this into a BLAST search page for me
TATCCACCAATTCCGGCGGCAAATGTGCACCGCCGGGAAGGCAAACTGTTAACTGTTACGCCAGGATTGCTTAGCGATTGCTTAGCTGGCCGGAGATTTGGAGATTTGTGATTTGCTGCAGCAGCAGCAGCAACCACAGGATCGCGAGGTGAGGTTCCCCATCTGCGCAAAGTGGAAAGTGGGCGATCCCACCAAGCGTTTTTGGCATCTATGCGTACCGGGCAGAGGATCCCTTGACGGCGGCCATTAATTAAGGCCGGATTTGTGCATGCCCAAAATTTCCCATTCTGCGAAGCATCAGCTTTCACAATTATCCTTCTACTTTGGAATATGACCCGAAACTCCGGCAT

Full Affymetrix probeset data:

Annotations for 1631867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720