Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631868_at:

>probe:Drosophila_2:1631868_at:418:597; Interrogation_Position=1991; Antisense; TGATTACTTTTGGTACCTGGGCTAA
>probe:Drosophila_2:1631868_at:61:419; Interrogation_Position=2076; Antisense; GAGACGTAAAATCGTATTTTCGCAA
>probe:Drosophila_2:1631868_at:352:527; Interrogation_Position=2103; Antisense; GGGAACATCTCTCAAGAACTCTTTA
>probe:Drosophila_2:1631868_at:572:707; Interrogation_Position=2125; Antisense; TTAAAATCCGCTAAGATCCATACGT
>probe:Drosophila_2:1631868_at:556:97; Interrogation_Position=2138; Antisense; AGATCCATACGTATATTTGCTCAGA
>probe:Drosophila_2:1631868_at:613:693; Interrogation_Position=2153; Antisense; TTTGCTCAGATTTTCGATTGCATTT
>probe:Drosophila_2:1631868_at:376:465; Interrogation_Position=2168; Antisense; GATTGCATTTTTTCGCTATTATTAA
>probe:Drosophila_2:1631868_at:66:167; Interrogation_Position=2213; Antisense; AAATGCCTCACAATTCGTTTTAATA
>probe:Drosophila_2:1631868_at:239:697; Interrogation_Position=2240; Antisense; TTTTCGATGCATTTGCAAACGGGAA
>probe:Drosophila_2:1631868_at:540:685; Interrogation_Position=2295; Antisense; TATCATTAATCATACCTTCTCGACG
>probe:Drosophila_2:1631868_at:120:203; Interrogation_Position=2333; Antisense; AACCAATTTGTTACTTGAGTGCGAG
>probe:Drosophila_2:1631868_at:502:431; Interrogation_Position=2349; Antisense; GAGTGCGAGAATAAACTTCAGTTTT
>probe:Drosophila_2:1631868_at:144:475; Interrogation_Position=2405; Antisense; GTTAATTAATTTTTTGCAGCCACAT
>probe:Drosophila_2:1631868_at:38:701; Interrogation_Position=2416; Antisense; TTTTGCAGCCACATAGACCTAGATG

Paste this into a BLAST search page for me
TGATTACTTTTGGTACCTGGGCTAAGAGACGTAAAATCGTATTTTCGCAAGGGAACATCTCTCAAGAACTCTTTATTAAAATCCGCTAAGATCCATACGTAGATCCATACGTATATTTGCTCAGATTTGCTCAGATTTTCGATTGCATTTGATTGCATTTTTTCGCTATTATTAAAAATGCCTCACAATTCGTTTTAATATTTTCGATGCATTTGCAAACGGGAATATCATTAATCATACCTTCTCGACGAACCAATTTGTTACTTGAGTGCGAGGAGTGCGAGAATAAACTTCAGTTTTGTTAATTAATTTTTTGCAGCCACATTTTTGCAGCCACATAGACCTAGATG

Full Affymetrix probeset data:

Annotations for 1631868_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime