FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631869_at:

>probe:Drosophila_2:1631869_at:349:157; Interrogation_Position=1050; Antisense; ACACGAATCTCGGTCAATAGCTCAC
>probe:Drosophila_2:1631869_at:37:207; Interrogation_Position=1098; Antisense; AAGCTGAGTCTCCAGTTCAAATCGA
>probe:Drosophila_2:1631869_at:616:115; Interrogation_Position=541; Antisense; AGCATCAACCAAGTCGCTTTTCGTT
>probe:Drosophila_2:1631869_at:95:201; Interrogation_Position=609; Antisense; AACGCCCTTTATGTTCTGTGGACGA
>probe:Drosophila_2:1631869_at:97:409; Interrogation_Position=629; Antisense; GACGATCGGCTTTGAGGCCTTCAAG
>probe:Drosophila_2:1631869_at:177:109; Interrogation_Position=652; Antisense; AGAACCGCGTATGGCAGTCATCTTC
>probe:Drosophila_2:1631869_at:506:149; Interrogation_Position=702; Antisense; ACATCGATCAGGGAGACGCGTGCTT
>probe:Drosophila_2:1631869_at:390:631; Interrogation_Position=801; Antisense; TCCTGGCTGTCGGACTTTGTTAGTT
>probe:Drosophila_2:1631869_at:63:477; Interrogation_Position=834; Antisense; GTTATTTATAAACCCATCCCGCTAT
>probe:Drosophila_2:1631869_at:345:43; Interrogation_Position=849; Antisense; ATCCCGCTATTTTTACGCCTATGGC
>probe:Drosophila_2:1631869_at:17:681; Interrogation_Position=868; Antisense; TATGGCACCAGTTGCTGTTCCAGTC
>probe:Drosophila_2:1631869_at:636:409; Interrogation_Position=908; Antisense; GACGACCACTGTTTGCTGTTGTTCT
>probe:Drosophila_2:1631869_at:389:9; Interrogation_Position=953; Antisense; ATTACGAGTAACACGGACTGCCCGA
>probe:Drosophila_2:1631869_at:708:459; Interrogation_Position=985; Antisense; GATTTCTGTTGTTGTGTACCCGGGA

Paste this into a BLAST search page for me
ACACGAATCTCGGTCAATAGCTCACAAGCTGAGTCTCCAGTTCAAATCGAAGCATCAACCAAGTCGCTTTTCGTTAACGCCCTTTATGTTCTGTGGACGAGACGATCGGCTTTGAGGCCTTCAAGAGAACCGCGTATGGCAGTCATCTTCACATCGATCAGGGAGACGCGTGCTTTCCTGGCTGTCGGACTTTGTTAGTTGTTATTTATAAACCCATCCCGCTATATCCCGCTATTTTTACGCCTATGGCTATGGCACCAGTTGCTGTTCCAGTCGACGACCACTGTTTGCTGTTGTTCTATTACGAGTAACACGGACTGCCCGAGATTTCTGTTGTTGTGTACCCGGGA

Full Affymetrix probeset data:

Annotations for 1631869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720