FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631870_at:

>probe:Drosophila_2:1631870_at:518:325; Interrogation_Position=5484; Antisense; GCGATATCTGTTTTGCCTGCAGGAT
>probe:Drosophila_2:1631870_at:16:49; Interrogation_Position=5507; Antisense; ATGCCTGGAATCTGGTATGTGAGCT
>probe:Drosophila_2:1631870_at:676:417; Interrogation_Position=5527; Antisense; GAGCTGTACTTGAGTAACTCTGCCC
>probe:Drosophila_2:1631870_at:592:193; Interrogation_Position=5542; Antisense; AACTCTGCCCTTCATGAGATCGAAA
>probe:Drosophila_2:1631870_at:223:625; Interrogation_Position=5658; Antisense; TGCCGAGATGACAGACACGGGCTCT
>probe:Drosophila_2:1631870_at:280:397; Interrogation_Position=5748; Antisense; GACAATGACCACGTTGATCAGCGAG
>probe:Drosophila_2:1631870_at:175:453; Interrogation_Position=5763; Antisense; GATCAGCGAGTTTCAGCCCAAGTGC
>probe:Drosophila_2:1631870_at:85:221; Interrogation_Position=5782; Antisense; AAGTGCCGTAGCAACCCGTTCGACA
>probe:Drosophila_2:1631870_at:559:237; Interrogation_Position=5809; Antisense; AATCGGCAGGCCAAGTCCTCGGAGG
>probe:Drosophila_2:1631870_at:657:573; Interrogation_Position=5832; Antisense; GGCGGAGTCAATTTCGCCGGAAATT
>probe:Drosophila_2:1631870_at:289:609; Interrogation_Position=5856; Antisense; TGAGCAGCAGCGAGCCAGCAGCATT
>probe:Drosophila_2:1631870_at:325:263; Interrogation_Position=5871; Antisense; CAGCAGCATTCTCAAAGACTCCAAC
>probe:Drosophila_2:1631870_at:11:657; Interrogation_Position=5987; Antisense; TAATGACCCCGACTATTCGCGAGGC
>probe:Drosophila_2:1631870_at:716:497; Interrogation_Position=6017; Antisense; GTCTAGTCCAGCTGCAGGGCAACGA

Paste this into a BLAST search page for me
GCGATATCTGTTTTGCCTGCAGGATATGCCTGGAATCTGGTATGTGAGCTGAGCTGTACTTGAGTAACTCTGCCCAACTCTGCCCTTCATGAGATCGAAATGCCGAGATGACAGACACGGGCTCTGACAATGACCACGTTGATCAGCGAGGATCAGCGAGTTTCAGCCCAAGTGCAAGTGCCGTAGCAACCCGTTCGACAAATCGGCAGGCCAAGTCCTCGGAGGGGCGGAGTCAATTTCGCCGGAAATTTGAGCAGCAGCGAGCCAGCAGCATTCAGCAGCATTCTCAAAGACTCCAACTAATGACCCCGACTATTCGCGAGGCGTCTAGTCCAGCTGCAGGGCAACGA

Full Affymetrix probeset data:

Annotations for 1631870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720