Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631871_at:

>probe:Drosophila_2:1631871_at:213:355; Interrogation_Position=2922; Antisense; GCACGTAATCATCGTATGACCGACG
>probe:Drosophila_2:1631871_at:501:555; Interrogation_Position=3008; Antisense; GGACCTGATGCGAACTCTAGCAGCA
>probe:Drosophila_2:1631871_at:13:659; Interrogation_Position=3025; Antisense; TAGCAGCATGCAACCGGGCGTACTC
>probe:Drosophila_2:1631871_at:341:465; Interrogation_Position=3040; Antisense; GGGCGTACTCAAGCTCATTTTTCGA
>probe:Drosophila_2:1631871_at:415:17; Interrogation_Position=3056; Antisense; ATTTTTCGAGCGGTCCTTGTCCCAG
>probe:Drosophila_2:1631871_at:407:375; Interrogation_Position=3083; Antisense; GAAGATCTGCATCGGTATCTCCAGC
>probe:Drosophila_2:1631871_at:258:593; Interrogation_Position=3127; Antisense; TGGTGGGAGCTTCTCAGCCGCACTA
>probe:Drosophila_2:1631871_at:649:1; Interrogation_Position=3225; Antisense; ACGGAGGAGTCAGCGAAAATTCTTC
>probe:Drosophila_2:1631871_at:154:665; Interrogation_Position=3263; Antisense; TAAATGTATATACCGCGGCATGACC
>probe:Drosophila_2:1631871_at:8:693; Interrogation_Position=3321; Antisense; TTTGTGGGCATTGACGAGAACCTTA
>probe:Drosophila_2:1631871_at:60:419; Interrogation_Position=3336; Antisense; GAGAACCTTAAATTTATGTCCGCAA
>probe:Drosophila_2:1631871_at:399:409; Interrogation_Position=3385; Antisense; GACGTTTCTCAGTTATGTCTTCACT
>probe:Drosophila_2:1631871_at:399:599; Interrogation_Position=3400; Antisense; TGTCTTCACTAGATCCGGATAGCCT
>probe:Drosophila_2:1631871_at:282:457; Interrogation_Position=3417; Antisense; GATAGCCTTAGGAAGAGTTCGTCTA

Paste this into a BLAST search page for me
GCACGTAATCATCGTATGACCGACGGGACCTGATGCGAACTCTAGCAGCATAGCAGCATGCAACCGGGCGTACTCGGGCGTACTCAAGCTCATTTTTCGAATTTTTCGAGCGGTCCTTGTCCCAGGAAGATCTGCATCGGTATCTCCAGCTGGTGGGAGCTTCTCAGCCGCACTAACGGAGGAGTCAGCGAAAATTCTTCTAAATGTATATACCGCGGCATGACCTTTGTGGGCATTGACGAGAACCTTAGAGAACCTTAAATTTATGTCCGCAAGACGTTTCTCAGTTATGTCTTCACTTGTCTTCACTAGATCCGGATAGCCTGATAGCCTTAGGAAGAGTTCGTCTA

Full Affymetrix probeset data:

Annotations for 1631871_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime