FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631872_at:

>probe:Drosophila_2:1631872_at:684:43; Interrogation_Position=1009; Antisense; ATCGCTGACCAATTATGCCAATCTA
>probe:Drosophila_2:1631872_at:703:219; Interrogation_Position=1033; Antisense; AAGTGCATACGGCATCGTGTCCACC
>probe:Drosophila_2:1631872_at:406:3; Interrogation_Position=1058; Antisense; ATTGTGGATCTCTTCCAGCATCTGG
>probe:Drosophila_2:1631872_at:336:641; Interrogation_Position=1078; Antisense; TCTGGGCCACGATAAGTGCGCCGAT
>probe:Drosophila_2:1631872_at:700:377; Interrogation_Position=1120; Antisense; GAAGCGCACCATGGACGAAGGCATT
>probe:Drosophila_2:1631872_at:563:369; Interrogation_Position=1136; Antisense; GAAGGCATTCGCACCAAGGAGTTCG
>probe:Drosophila_2:1631872_at:194:673; Interrogation_Position=1171; Antisense; TACCGGCGAGTATGTCATTTGCAAC
>probe:Drosophila_2:1631872_at:697:433; Interrogation_Position=737; Antisense; GAGTGGCCCATTAGCGATGGCTCAC
>probe:Drosophila_2:1631872_at:556:67; Interrogation_Position=753; Antisense; ATGGCTCACTGGTGGAAGCCGCACA
>probe:Drosophila_2:1631872_at:450:223; Interrogation_Position=797; Antisense; AAGGATTGCCTGGAGCTGGAGCTCA
>probe:Drosophila_2:1631872_at:8:685; Interrogation_Position=909; Antisense; TATCCGCCATCTGCAGTGGAGTCTG
>probe:Drosophila_2:1631872_at:98:525; Interrogation_Position=939; Antisense; GGGCTAATCTCTTCAGTGCGGTGGA
>probe:Drosophila_2:1631872_at:424:551; Interrogation_Position=968; Antisense; GGAGATCACCATGCCGTTTTCAAAC
>probe:Drosophila_2:1631872_at:712:707; Interrogation_Position=986; Antisense; TTCAAACCGCTCCAGACGAAACTAT

Paste this into a BLAST search page for me
ATCGCTGACCAATTATGCCAATCTAAAGTGCATACGGCATCGTGTCCACCATTGTGGATCTCTTCCAGCATCTGGTCTGGGCCACGATAAGTGCGCCGATGAAGCGCACCATGGACGAAGGCATTGAAGGCATTCGCACCAAGGAGTTCGTACCGGCGAGTATGTCATTTGCAACGAGTGGCCCATTAGCGATGGCTCACATGGCTCACTGGTGGAAGCCGCACAAAGGATTGCCTGGAGCTGGAGCTCATATCCGCCATCTGCAGTGGAGTCTGGGGCTAATCTCTTCAGTGCGGTGGAGGAGATCACCATGCCGTTTTCAAACTTCAAACCGCTCCAGACGAAACTAT

Full Affymetrix probeset data:

Annotations for 1631872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720