FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631876_at:

>probe:Drosophila_2:1631876_at:643:85; Interrogation_Position=143; Antisense; AGTGCATCGGGCAGTACAACGAGGA
>probe:Drosophila_2:1631876_at:227:549; Interrogation_Position=174; Antisense; GGAGTACGTCCAGCTGAAGAACACC
>probe:Drosophila_2:1631876_at:343:177; Interrogation_Position=236; Antisense; AAACGCAAGTCAACATCGGCAGCAA
>probe:Drosophila_2:1631876_at:720:39; Interrogation_Position=250; Antisense; ATCGGCAGCAACGTATTCATGCAGG
>probe:Drosophila_2:1631876_at:46:713; Interrogation_Position=265; Antisense; TTCATGCAGGCTCGCGTTCGGAAAA
>probe:Drosophila_2:1631876_at:272:27; Interrogation_Position=293; Antisense; ATAGCATTCTGGTCGATGTGGGCAA
>probe:Drosophila_2:1631876_at:676:513; Interrogation_Position=322; Antisense; GTGTTCCTCGATATGAGCATTCCAG
>probe:Drosophila_2:1631876_at:662:97; Interrogation_Position=345; Antisense; AGATGCGGAACGCTTCTGCGACACA
>probe:Drosophila_2:1631876_at:16:625; Interrogation_Position=361; Antisense; TGCGACACACGCGTAAAGATCTTGA
>probe:Drosophila_2:1631876_at:540:451; Interrogation_Position=378; Antisense; GATCTTGACCAAGCAATCCGATGTC
>probe:Drosophila_2:1631876_at:597:235; Interrogation_Position=392; Antisense; AATCCGATGTCCTGCGCGACGAAAG
>probe:Drosophila_2:1631876_at:96:229; Interrogation_Position=441; Antisense; AATGGCCCTCATAGCAATCAGCGAA
>probe:Drosophila_2:1631876_at:336:397; Interrogation_Position=50; Antisense; GACAAGCCGAGCAGGATGCCAACAA
>probe:Drosophila_2:1631876_at:514:69; Interrogation_Position=74; Antisense; AGGCGCGAATCACCCAAATTGAGGA

Paste this into a BLAST search page for me
AGTGCATCGGGCAGTACAACGAGGAGGAGTACGTCCAGCTGAAGAACACCAAACGCAAGTCAACATCGGCAGCAAATCGGCAGCAACGTATTCATGCAGGTTCATGCAGGCTCGCGTTCGGAAAAATAGCATTCTGGTCGATGTGGGCAAGTGTTCCTCGATATGAGCATTCCAGAGATGCGGAACGCTTCTGCGACACATGCGACACACGCGTAAAGATCTTGAGATCTTGACCAAGCAATCCGATGTCAATCCGATGTCCTGCGCGACGAAAGAATGGCCCTCATAGCAATCAGCGAAGACAAGCCGAGCAGGATGCCAACAAAGGCGCGAATCACCCAAATTGAGGA

Full Affymetrix probeset data:

Annotations for 1631876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720