FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631880_at:

>probe:Drosophila_2:1631880_at:284:47; Interrogation_Position=1716; Antisense; ATCCATCATCAAATGCTGCCCAATG
>probe:Drosophila_2:1631880_at:162:625; Interrogation_Position=1732; Antisense; TGCCCAATGTTCTGCTCTACGAGTA
>probe:Drosophila_2:1631880_at:38:339; Interrogation_Position=1745; Antisense; GCTCTACGAGTATGGACTACGGCAG
>probe:Drosophila_2:1631880_at:679:555; Interrogation_Position=1758; Antisense; GGACTACGGCAGAGCTATGTGGATA
>probe:Drosophila_2:1631880_at:450:43; Interrogation_Position=1801; Antisense; ATCGATGCGAGCGTTATGAGAACCG
>probe:Drosophila_2:1631880_at:687:421; Interrogation_Position=1818; Antisense; GAGAACCGCGGTTCCGTCATCTGTG
>probe:Drosophila_2:1631880_at:508:497; Interrogation_Position=1833; Antisense; GTCATCTGTGGAATCGCTCAAGCTA
>probe:Drosophila_2:1631880_at:15:339; Interrogation_Position=1848; Antisense; GCTCAAGCTAACGACACCATCTGGG
>probe:Drosophila_2:1631880_at:582:259; Interrogation_Position=1862; Antisense; CACCATCTGGGTGAACTCGGATTTT
>probe:Drosophila_2:1631880_at:421:381; Interrogation_Position=1874; Antisense; GAACTCGGATTTTCGGAAGCCAGGT
>probe:Drosophila_2:1631880_at:181:699; Interrogation_Position=2070; Antisense; TTTTTAGATGCTATCGCACGAAAGC
>probe:Drosophila_2:1631880_at:511:665; Interrogation_Position=2213; Antisense; TACAATATATCCCTACACAGACGTG
>probe:Drosophila_2:1631880_at:727:511; Interrogation_Position=2235; Antisense; GTGTAAAAGTGTTCTCGCTTGCGGT
>probe:Drosophila_2:1631880_at:159:715; Interrogation_Position=2246; Antisense; TTCTCGCTTGCGGTGGCAACAAATA

Paste this into a BLAST search page for me
ATCCATCATCAAATGCTGCCCAATGTGCCCAATGTTCTGCTCTACGAGTAGCTCTACGAGTATGGACTACGGCAGGGACTACGGCAGAGCTATGTGGATAATCGATGCGAGCGTTATGAGAACCGGAGAACCGCGGTTCCGTCATCTGTGGTCATCTGTGGAATCGCTCAAGCTAGCTCAAGCTAACGACACCATCTGGGCACCATCTGGGTGAACTCGGATTTTGAACTCGGATTTTCGGAAGCCAGGTTTTTTAGATGCTATCGCACGAAAGCTACAATATATCCCTACACAGACGTGGTGTAAAAGTGTTCTCGCTTGCGGTTTCTCGCTTGCGGTGGCAACAAATA

Full Affymetrix probeset data:

Annotations for 1631880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720