FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631882_at:

>probe:Drosophila_2:1631882_at:32:703; Interrogation_Position=264; Antisense; TTTTGAGCCCCTAAACATTGACCAG
>probe:Drosophila_2:1631882_at:250:599; Interrogation_Position=290; Antisense; TGTCGGTATCCAAGGGCAGCGGCAA
>probe:Drosophila_2:1631882_at:685:253; Interrogation_Position=312; Antisense; CAACCTGGTGCTATCCGGAGGATTT
>probe:Drosophila_2:1631882_at:265:407; Interrogation_Position=369; Antisense; GACTGTGCGACGAGCCAGCTTGGAT
>probe:Drosophila_2:1631882_at:495:543; Interrogation_Position=440; Antisense; GGATCCGGGCGAAGTACAACCTGAA
>probe:Drosophila_2:1631882_at:696:393; Interrogation_Position=467; Antisense; GAAATATCCTACTTTTGCCCCTTGT
>probe:Drosophila_2:1631882_at:289:103; Interrogation_Position=501; Antisense; AGACGTGGCTATGGCGCTGAAGAAC
>probe:Drosophila_2:1631882_at:693:157; Interrogation_Position=542; Antisense; ACACAAGGATCTCTCTACGGAACGA
>probe:Drosophila_2:1631882_at:114:571; Interrogation_Position=613; Antisense; GGCTTCGATGTAGGCGCCATGAGAA
>probe:Drosophila_2:1631882_at:463:391; Interrogation_Position=662; Antisense; GAAACGAAATTCTCGCGGCATCGAT
>probe:Drosophila_2:1631882_at:591:569; Interrogation_Position=678; Antisense; GGCATCGATTAACTCCTTTCTGAAT
>probe:Drosophila_2:1631882_at:395:407; Interrogation_Position=752; Antisense; GACTGGCAGACATCTTTCATGGACT
>probe:Drosophila_2:1631882_at:10:187; Interrogation_Position=781; Antisense; AACAATGTCTTCTCCAAGATGCCCA
>probe:Drosophila_2:1631882_at:269:215; Interrogation_Position=796; Antisense; AAGATGCCCACCAAACTGTGGCTGG

Paste this into a BLAST search page for me
TTTTGAGCCCCTAAACATTGACCAGTGTCGGTATCCAAGGGCAGCGGCAACAACCTGGTGCTATCCGGAGGATTTGACTGTGCGACGAGCCAGCTTGGATGGATCCGGGCGAAGTACAACCTGAAGAAATATCCTACTTTTGCCCCTTGTAGACGTGGCTATGGCGCTGAAGAACACACAAGGATCTCTCTACGGAACGAGGCTTCGATGTAGGCGCCATGAGAAGAAACGAAATTCTCGCGGCATCGATGGCATCGATTAACTCCTTTCTGAATGACTGGCAGACATCTTTCATGGACTAACAATGTCTTCTCCAAGATGCCCAAAGATGCCCACCAAACTGTGGCTGG

Full Affymetrix probeset data:

Annotations for 1631882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720