Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631885_at:

>probe:Drosophila_2:1631885_at:335:379; Interrogation_Position=4082; Antisense; GAAGCGTCAGTTGTTCCAGAAGCAG
>probe:Drosophila_2:1631885_at:193:351; Interrogation_Position=4103; Antisense; GCAGTACGCACTGGAGGCGCAGCTA
>probe:Drosophila_2:1631885_at:376:35; Interrogation_Position=4228; Antisense; ATCACCTGGCCGACGAGTTGTACGA
>probe:Drosophila_2:1631885_at:578:669; Interrogation_Position=4248; Antisense; TACGAGTTGGCCTTGCTTGATCGGC
>probe:Drosophila_2:1631885_at:51:555; Interrogation_Position=4276; Antisense; GGAGCGGAACTCCTAGGCTTCAGCA
>probe:Drosophila_2:1631885_at:427:419; Interrogation_Position=4318; Antisense; GAGCTCATGCCTTCAGTCAGATGAA
>probe:Drosophila_2:1631885_at:583:613; Interrogation_Position=4339; Antisense; TGAACCTCAAGACTTCCTACATCAG
>probe:Drosophila_2:1631885_at:241:665; Interrogation_Position=4356; Antisense; TACATCAGCCAATCGGACCAGGTGC
>probe:Drosophila_2:1631885_at:319:621; Interrogation_Position=4385; Antisense; TGCGGCGCCTAATGGAGCTGGTTCC
>probe:Drosophila_2:1631885_at:250:539; Interrogation_Position=4461; Antisense; GGTACGCCCACGGTCAAGTGCAAGC
>probe:Drosophila_2:1631885_at:331:557; Interrogation_Position=4511; Antisense; GGACTCCGACTATCATACATCGACG
>probe:Drosophila_2:1631885_at:636:133; Interrogation_Position=4554; Antisense; ACGCCCAATTGGCAGTCGCTGGTAA
>probe:Drosophila_2:1631885_at:172:103; Interrogation_Position=4591; Antisense; AGAGCCCCATCCTGGAGATATCGGA
>probe:Drosophila_2:1631885_at:518:23; Interrogation_Position=4608; Antisense; ATATCGGAGCACCTTGAGTCAGTCT

Paste this into a BLAST search page for me
GAAGCGTCAGTTGTTCCAGAAGCAGGCAGTACGCACTGGAGGCGCAGCTAATCACCTGGCCGACGAGTTGTACGATACGAGTTGGCCTTGCTTGATCGGCGGAGCGGAACTCCTAGGCTTCAGCAGAGCTCATGCCTTCAGTCAGATGAATGAACCTCAAGACTTCCTACATCAGTACATCAGCCAATCGGACCAGGTGCTGCGGCGCCTAATGGAGCTGGTTCCGGTACGCCCACGGTCAAGTGCAAGCGGACTCCGACTATCATACATCGACGACGCCCAATTGGCAGTCGCTGGTAAAGAGCCCCATCCTGGAGATATCGGAATATCGGAGCACCTTGAGTCAGTCT

Full Affymetrix probeset data:

Annotations for 1631885_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime