FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631886_at:

>probe:Drosophila_2:1631886_at:177:215; Interrogation_Position=131; Antisense; AAGATGACGACTGTCCTTCAGGTCC
>probe:Drosophila_2:1631886_at:60:487; Interrogation_Position=152; Antisense; GTCCCCGGCTCGTGGAAGTAGAAAT
>probe:Drosophila_2:1631886_at:284:161; Interrogation_Position=173; Antisense; AAATATTGGATCCTCTTAACCCGCA
>probe:Drosophila_2:1631886_at:348:511; Interrogation_Position=250; Antisense; GTGAAGCACTTGGAGCTCGAAATAT
>probe:Drosophila_2:1631886_at:503:393; Interrogation_Position=331; Antisense; GAAATGCGTAATCTCAAGGACACAA
>probe:Drosophila_2:1631886_at:35:293; Interrogation_Position=417; Antisense; CGTTTTGAAATCGACCTGCACTGCA
>probe:Drosophila_2:1631886_at:95:617; Interrogation_Position=433; Antisense; TGCACTGCAAGCGATGTTCTCCGAC
>probe:Drosophila_2:1631886_at:541:381; Interrogation_Position=47; Antisense; GAACGCAATCCTCGGAAGGCCACGA
>probe:Drosophila_2:1631886_at:258:553; Interrogation_Position=495; Antisense; GGAGCTTCACGTATCCGGCGCTGGA
>probe:Drosophila_2:1631886_at:470:631; Interrogation_Position=508; Antisense; TCCGGCGCTGGATCTCTGAAGAATC
>probe:Drosophila_2:1631886_at:389:199; Interrogation_Position=537; Antisense; AACGAGAGCGACGTGGAACACCACA
>probe:Drosophila_2:1631886_at:589:561; Interrogation_Position=551; Antisense; GGAACACCACACATCCTGGGAGCAA
>probe:Drosophila_2:1631886_at:278:547; Interrogation_Position=582; Antisense; GGATCCAATCTTGAAGACCATGCAG
>probe:Drosophila_2:1631886_at:687:349; Interrogation_Position=603; Antisense; GCAGTGTCAGCATATTAGCCGAATT

Paste this into a BLAST search page for me
AAGATGACGACTGTCCTTCAGGTCCGTCCCCGGCTCGTGGAAGTAGAAATAAATATTGGATCCTCTTAACCCGCAGTGAAGCACTTGGAGCTCGAAATATGAAATGCGTAATCTCAAGGACACAACGTTTTGAAATCGACCTGCACTGCATGCACTGCAAGCGATGTTCTCCGACGAACGCAATCCTCGGAAGGCCACGAGGAGCTTCACGTATCCGGCGCTGGATCCGGCGCTGGATCTCTGAAGAATCAACGAGAGCGACGTGGAACACCACAGGAACACCACACATCCTGGGAGCAAGGATCCAATCTTGAAGACCATGCAGGCAGTGTCAGCATATTAGCCGAATT

Full Affymetrix probeset data:

Annotations for 1631886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720