FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631888_at:

>probe:Drosophila_2:1631888_at:59:41; Interrogation_Position=1541; Antisense; ATCTGTTTTGTGTATCCGCATCTTT
>probe:Drosophila_2:1631888_at:419:621; Interrogation_Position=1598; Antisense; TGCTCCTTCCGGACTTCTAAAAATT
>probe:Drosophila_2:1631888_at:323:325; Interrogation_Position=1638; Antisense; GCGAACTGCGTCGTGATATCCAGAT
>probe:Drosophila_2:1631888_at:177:51; Interrogation_Position=1691; Antisense; ATGCGATGCCCATGAGCTTGTGAGC
>probe:Drosophila_2:1631888_at:507:511; Interrogation_Position=1710; Antisense; GTGAGCCCCATCCAAGAACAGCAAG
>probe:Drosophila_2:1631888_at:305:163; Interrogation_Position=1756; Antisense; AAATTCCTGTTAATGCCCGTCTTAG
>probe:Drosophila_2:1631888_at:471:89; Interrogation_Position=1827; Antisense; AGTCTTTGTCCCCAGAGCAGAGATC
>probe:Drosophila_2:1631888_at:379:101; Interrogation_Position=1845; Antisense; AGAGATCCTCAGATTGCGGGACAAT
>probe:Drosophila_2:1631888_at:271:359; Interrogation_Position=1870; Antisense; GCAACTTGCTGAATGGTAATCCACT
>probe:Drosophila_2:1631888_at:102:491; Interrogation_Position=1885; Antisense; GTAATCCACTTAATCCGGGTAACTG
>probe:Drosophila_2:1631888_at:429:129; Interrogation_Position=1945; Antisense; ACCTGGCCAGCTCTAAACGTTTAAT
>probe:Drosophila_2:1631888_at:523:697; Interrogation_Position=1973; Antisense; TTTATTTACTTTCCCGACGCGTGCA
>probe:Drosophila_2:1631888_at:595:647; Interrogation_Position=2007; Antisense; TCAGTGGCTCATTGGCTCTGCGGAA
>probe:Drosophila_2:1631888_at:641:571; Interrogation_Position=2020; Antisense; GGCTCTGCGGAACTGCACTGTAAAT

Paste this into a BLAST search page for me
ATCTGTTTTGTGTATCCGCATCTTTTGCTCCTTCCGGACTTCTAAAAATTGCGAACTGCGTCGTGATATCCAGATATGCGATGCCCATGAGCTTGTGAGCGTGAGCCCCATCCAAGAACAGCAAGAAATTCCTGTTAATGCCCGTCTTAGAGTCTTTGTCCCCAGAGCAGAGATCAGAGATCCTCAGATTGCGGGACAATGCAACTTGCTGAATGGTAATCCACTGTAATCCACTTAATCCGGGTAACTGACCTGGCCAGCTCTAAACGTTTAATTTTATTTACTTTCCCGACGCGTGCATCAGTGGCTCATTGGCTCTGCGGAAGGCTCTGCGGAACTGCACTGTAAAT

Full Affymetrix probeset data:

Annotations for 1631888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720