FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631889_at:

>probe:Drosophila_2:1631889_at:593:205; Interrogation_Position=1031; Antisense; AAGCTTTTAAGCGTCCACTCGCTGA
>probe:Drosophila_2:1631889_at:512:713; Interrogation_Position=495; Antisense; TTCATGCAGTAAGTGTTCCTCCTCC
>probe:Drosophila_2:1631889_at:572:551; Interrogation_Position=571; Antisense; GGAGACGATCTCAGAGCGGCTGTTC
>probe:Drosophila_2:1631889_at:281:331; Interrogation_Position=586; Antisense; GCGGCTGTTCGGTCCCAAATAGAGG
>probe:Drosophila_2:1631889_at:723:437; Interrogation_Position=616; Antisense; GAGGCCTTGAATGCGTTTACACTTG
>probe:Drosophila_2:1631889_at:624:375; Interrogation_Position=676; Antisense; GAAGAACGCAGTACCAAGCCCAAAA
>probe:Drosophila_2:1631889_at:487:245; Interrogation_Position=711; Antisense; AATTACGTCTCATACGCAAGCCGAG
>probe:Drosophila_2:1631889_at:456:359; Interrogation_Position=726; Antisense; GCAAGCCGAGAAAGTGGATCCCACT
>probe:Drosophila_2:1631889_at:213:369; Interrogation_Position=754; Antisense; GAATGCGCCCAATTAGATACCCTAG
>probe:Drosophila_2:1631889_at:132:383; Interrogation_Position=793; Antisense; GAACTCGTGGATCTAAGTGGCAGTC
>probe:Drosophila_2:1631889_at:144:513; Interrogation_Position=821; Antisense; GTGATGCCGCTATTACCAATGTGGA
>probe:Drosophila_2:1631889_at:552:511; Interrogation_Position=851; Antisense; GTGACAGTCCTGGTGATGCAGCTAT
>probe:Drosophila_2:1631889_at:130:395; Interrogation_Position=982; Antisense; GAAATGTCCCTCATGGAGTATCTAG
>probe:Drosophila_2:1631889_at:600:429; Interrogation_Position=997; Antisense; GAGTATCTAGTTACGGTCCCGGAAT

Paste this into a BLAST search page for me
AAGCTTTTAAGCGTCCACTCGCTGATTCATGCAGTAAGTGTTCCTCCTCCGGAGACGATCTCAGAGCGGCTGTTCGCGGCTGTTCGGTCCCAAATAGAGGGAGGCCTTGAATGCGTTTACACTTGGAAGAACGCAGTACCAAGCCCAAAAAATTACGTCTCATACGCAAGCCGAGGCAAGCCGAGAAAGTGGATCCCACTGAATGCGCCCAATTAGATACCCTAGGAACTCGTGGATCTAAGTGGCAGTCGTGATGCCGCTATTACCAATGTGGAGTGACAGTCCTGGTGATGCAGCTATGAAATGTCCCTCATGGAGTATCTAGGAGTATCTAGTTACGGTCCCGGAAT

Full Affymetrix probeset data:

Annotations for 1631889_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720