FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631891_at:

>probe:Drosophila_2:1631891_at:3:301; Interrogation_Position=1487; Antisense; CGCCCGAAGCTCTATTGGATTTCTA
>probe:Drosophila_2:1631891_at:341:597; Interrogation_Position=1526; Antisense; TGTGCAATGGCTATCTGAGCGCGTT
>probe:Drosophila_2:1631891_at:428:609; Interrogation_Position=1541; Antisense; TGAGCGCGTTGAACGAGCTGCGTCT
>probe:Drosophila_2:1631891_at:279:649; Interrogation_Position=1632; Antisense; TCAGCGTGTGCTTGCCTTTTATCGG
>probe:Drosophila_2:1631891_at:623:41; Interrogation_Position=1652; Antisense; ATCGGCAAGAGCAGCAGGCCTTCGC
>probe:Drosophila_2:1631891_at:155:101; Interrogation_Position=1689; Antisense; AGAGGCATTTGTTCGGCTCTGCTCA
>probe:Drosophila_2:1631891_at:33:671; Interrogation_Position=1723; Antisense; TACGACCTGGTACCCTATATTCAGA
>probe:Drosophila_2:1631891_at:168:101; Interrogation_Position=1745; Antisense; AGAGGTGCATCCATGGAGTCTTCCC
>probe:Drosophila_2:1631891_at:588:659; Interrogation_Position=1781; Antisense; TAACCGTTCACTTGGGCATTAGCTT
>probe:Drosophila_2:1631891_at:363:345; Interrogation_Position=1796; Antisense; GCATTAGCTTGCTTCAGCTGGAGCA
>probe:Drosophila_2:1631891_at:510:721; Interrogation_Position=1837; Antisense; TTGCAGCAGACTCGCATTCTTGAGC
>probe:Drosophila_2:1631891_at:712:9; Interrogation_Position=1852; Antisense; ATTCTTGAGCCCTTGAAGCACTTAC
>probe:Drosophila_2:1631891_at:718:723; Interrogation_Position=1864; Antisense; TTGAAGCACTTACTGCCGACCAAGG
>probe:Drosophila_2:1631891_at:458:505; Interrogation_Position=1939; Antisense; GTGCCTGTCACTGCCGAGGGATAAA

Paste this into a BLAST search page for me
CGCCCGAAGCTCTATTGGATTTCTATGTGCAATGGCTATCTGAGCGCGTTTGAGCGCGTTGAACGAGCTGCGTCTTCAGCGTGTGCTTGCCTTTTATCGGATCGGCAAGAGCAGCAGGCCTTCGCAGAGGCATTTGTTCGGCTCTGCTCATACGACCTGGTACCCTATATTCAGAAGAGGTGCATCCATGGAGTCTTCCCTAACCGTTCACTTGGGCATTAGCTTGCATTAGCTTGCTTCAGCTGGAGCATTGCAGCAGACTCGCATTCTTGAGCATTCTTGAGCCCTTGAAGCACTTACTTGAAGCACTTACTGCCGACCAAGGGTGCCTGTCACTGCCGAGGGATAAA

Full Affymetrix probeset data:

Annotations for 1631891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720