Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631899_a_at:

>probe:Drosophila_2:1631899_a_at:445:107; Interrogation_Position=112; Antisense; AGAAACTGCTCATCGATGTCCGGGA
>probe:Drosophila_2:1631899_a_at:419:31; Interrogation_Position=177; Antisense; ATCAACATCCCTCTGGGCGTGGTTA
>probe:Drosophila_2:1631899_a_at:38:703; Interrogation_Position=199; Antisense; TTAGTCAGGAATTGGCGGCCAGTGA
>probe:Drosophila_2:1631899_a_at:24:575; Interrogation_Position=212; Antisense; GGCGGCCAGTGAGCAGCTTTTTAAA
>probe:Drosophila_2:1631899_a_at:70:427; Interrogation_Position=273; Antisense; GAGATTATATTCCACTGCAAGATTG
>probe:Drosophila_2:1631899_a_at:601:203; Interrogation_Position=305; Antisense; AAGCCTTAAGGCTGCAGAAGCTGCC
>probe:Drosophila_2:1631899_a_at:349:283; Interrogation_Position=325; Antisense; CTGCCGCCGCATTGGGATTCAAGAA
>probe:Drosophila_2:1631899_a_at:188:383; Interrogation_Position=356; Antisense; GAACTACCAGGGATCTTGGCTGGAT
>probe:Drosophila_2:1631899_a_at:97:433; Interrogation_Position=393; Antisense; GAGGGCCTGCCCAAGTAAATAACAT
>probe:Drosophila_2:1631899_a_at:724:401; Interrogation_Position=433; Antisense; GACATTATCCATCTGGTTAATCCAT
>probe:Drosophila_2:1631899_a_at:257:359; Interrogation_Position=464; Antisense; GCAACAATAATTCCATTTCGCCCAA
>probe:Drosophila_2:1631899_a_at:121:315; Interrogation_Position=49; Antisense; GCCAGGCTCCTCAAATTGGAATCGT
>probe:Drosophila_2:1631899_a_at:167:555; Interrogation_Position=74; Antisense; GGACTACGACGTGGTCAAGAAACTA
>probe:Drosophila_2:1631899_a_at:572:207; Interrogation_Position=90; Antisense; AAGAAACTACCCAGCGAACCACAGA

Paste this into a BLAST search page for me
AGAAACTGCTCATCGATGTCCGGGAATCAACATCCCTCTGGGCGTGGTTATTAGTCAGGAATTGGCGGCCAGTGAGGCGGCCAGTGAGCAGCTTTTTAAAGAGATTATATTCCACTGCAAGATTGAAGCCTTAAGGCTGCAGAAGCTGCCCTGCCGCCGCATTGGGATTCAAGAAGAACTACCAGGGATCTTGGCTGGATGAGGGCCTGCCCAAGTAAATAACATGACATTATCCATCTGGTTAATCCATGCAACAATAATTCCATTTCGCCCAAGCCAGGCTCCTCAAATTGGAATCGTGGACTACGACGTGGTCAAGAAACTAAAGAAACTACCCAGCGAACCACAGA

Full Affymetrix probeset data:

Annotations for 1631899_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime