FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631903_at:

>probe:Drosophila_2:1631903_at:597:411; Interrogation_Position=359; Antisense; GACCCTGTGTCCAATTTAGTTCGGA
>probe:Drosophila_2:1631903_at:252:377; Interrogation_Position=406; Antisense; GAAGCTAGCTATACGGTCCGAAATA
>probe:Drosophila_2:1631903_at:188:239; Interrogation_Position=427; Antisense; AATATCCACGGCACCTTTAGGAGGC
>probe:Drosophila_2:1631903_at:388:685; Interrogation_Position=474; Antisense; TATACCGAACAACCGCGATGTGATC
>probe:Drosophila_2:1631903_at:287:597; Interrogation_Position=492; Antisense; TGTGATCATCAATCGCGGACATCTG
>probe:Drosophila_2:1631903_at:313:319; Interrogation_Position=526; Antisense; GCCGACTTCTTCTTTGGTGACCAAT
>probe:Drosophila_2:1631903_at:110:63; Interrogation_Position=569; Antisense; ATGTGAATGCAGTGCCGCAGTTCAA
>probe:Drosophila_2:1631903_at:525:551; Interrogation_Position=615; Antisense; GGAGACCATCGAGCGATTCGTTCGT
>probe:Drosophila_2:1631903_at:334:463; Interrogation_Position=629; Antisense; GATTCGTTCGTAATTCGGTGACCGG
>probe:Drosophila_2:1631903_at:599:109; Interrogation_Position=722; Antisense; AGAATGTCTTCCTAAGTGGCAACAG
>probe:Drosophila_2:1631903_at:118:305; Interrogation_Position=751; Antisense; CCGGTGCCCCAGTGGATGTACAAGA
>probe:Drosophila_2:1631903_at:249:255; Interrogation_Position=858; Antisense; CAACTTTTGTCAGCCCGTGAATTGC
>probe:Drosophila_2:1631903_at:277:345; Interrogation_Position=889; Antisense; GCATTGGTCAACACGGCACAGGCTG
>probe:Drosophila_2:1631903_at:84:71; Interrogation_Position=908; Antisense; AGGCTGGCTTTTCGTTCTGTTGCAA

Paste this into a BLAST search page for me
GACCCTGTGTCCAATTTAGTTCGGAGAAGCTAGCTATACGGTCCGAAATAAATATCCACGGCACCTTTAGGAGGCTATACCGAACAACCGCGATGTGATCTGTGATCATCAATCGCGGACATCTGGCCGACTTCTTCTTTGGTGACCAATATGTGAATGCAGTGCCGCAGTTCAAGGAGACCATCGAGCGATTCGTTCGTGATTCGTTCGTAATTCGGTGACCGGAGAATGTCTTCCTAAGTGGCAACAGCCGGTGCCCCAGTGGATGTACAAGACAACTTTTGTCAGCCCGTGAATTGCGCATTGGTCAACACGGCACAGGCTGAGGCTGGCTTTTCGTTCTGTTGCAA

Full Affymetrix probeset data:

Annotations for 1631903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720