FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631907_at:

>probe:Drosophila_2:1631907_at:251:83; Interrogation_Position=162; Antisense; AGGGCTCTGCAATTTGGTGCTACCG
>probe:Drosophila_2:1631907_at:450:241; Interrogation_Position=235; Antisense; AATAGGATTCCTGGGCGAGCACTGC
>probe:Drosophila_2:1631907_at:480:561; Interrogation_Position=262; Antisense; GGAACCGGACGACATTTGCGTCAAG
>probe:Drosophila_2:1631907_at:155:411; Interrogation_Position=297; Antisense; GACGCGGCGCCAGGGAAACAATCAC
>probe:Drosophila_2:1631907_at:52:241; Interrogation_Position=316; Antisense; AATCACACGTGACTGCCTAAGCGCG
>probe:Drosophila_2:1631907_at:93:659; Interrogation_Position=333; Antisense; TAAGCGCGCTGAGCTTCCGCAAAGA
>probe:Drosophila_2:1631907_at:41:403; Interrogation_Position=356; Antisense; GACATTCCCGCCGACAAATACGAAG
>probe:Drosophila_2:1631907_at:488:509; Interrogation_Position=456; Antisense; GTGACTACTACACGGACACCACGTT
>probe:Drosophila_2:1631907_at:326:491; Interrogation_Position=539; Antisense; GTAATCGGTCTTCTCACTCTAATTC
>probe:Drosophila_2:1631907_at:290:341; Interrogation_Position=579; Antisense; GCTAGAATCTCCTCTTGAGTGCAGT
>probe:Drosophila_2:1631907_at:176:711; Interrogation_Position=606; Antisense; TTAAGTGCCTTACTAACTCGCTCTG
>probe:Drosophila_2:1631907_at:593:613; Interrogation_Position=629; Antisense; TGCAACTACGAATTCCGTCCAACAT
>probe:Drosophila_2:1631907_at:338:505; Interrogation_Position=645; Antisense; GTCCAACATTCCACACTTTTTGTAC
>probe:Drosophila_2:1631907_at:143:125; Interrogation_Position=671; Antisense; ACCTTTTGACATGACTACAGCTTTT

Paste this into a BLAST search page for me
AGGGCTCTGCAATTTGGTGCTACCGAATAGGATTCCTGGGCGAGCACTGCGGAACCGGACGACATTTGCGTCAAGGACGCGGCGCCAGGGAAACAATCACAATCACACGTGACTGCCTAAGCGCGTAAGCGCGCTGAGCTTCCGCAAAGAGACATTCCCGCCGACAAATACGAAGGTGACTACTACACGGACACCACGTTGTAATCGGTCTTCTCACTCTAATTCGCTAGAATCTCCTCTTGAGTGCAGTTTAAGTGCCTTACTAACTCGCTCTGTGCAACTACGAATTCCGTCCAACATGTCCAACATTCCACACTTTTTGTACACCTTTTGACATGACTACAGCTTTT

Full Affymetrix probeset data:

Annotations for 1631907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720