Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631909_at:

>probe:Drosophila_2:1631909_at:280:579; Interrogation_Position=247; Antisense; GGCCAGATCATCGACTACATTGCAC
>probe:Drosophila_2:1631909_at:532:667; Interrogation_Position=262; Antisense; TACATTGCACGCGACACCAAGGGAC
>probe:Drosophila_2:1631909_at:569:251; Interrogation_Position=321; Antisense; CAAGTTCAGCTTCATGTCCGAGGTG
>probe:Drosophila_2:1631909_at:25:683; Interrogation_Position=371; Antisense; TATCCAAAGTTCCTGCACATCAACG
>probe:Drosophila_2:1631909_at:70:267; Interrogation_Position=406; Antisense; CAGGAAGTATCGCTCTTGACCAAAA
>probe:Drosophila_2:1631909_at:629:143; Interrogation_Position=477; Antisense; ACTGAAGCCCCTTGAAGTTGATCTT
>probe:Drosophila_2:1631909_at:587:205; Interrogation_Position=502; Antisense; AAGCGTTTGGAGGATCTCTCCGACT
>probe:Drosophila_2:1631909_at:379:145; Interrogation_Position=524; Antisense; ACTCCATTGTGCGTGATTTCGTTCT
>probe:Drosophila_2:1631909_at:114:19; Interrogation_Position=539; Antisense; ATTTCGTTCTCATGCGCAAGCGGGA
>probe:Drosophila_2:1631909_at:86:57; Interrogation_Position=584; Antisense; ATGAGAAAACCAACAGCCGCGTGCT
>probe:Drosophila_2:1631909_at:192:583; Interrogation_Position=647; Antisense; TGGCGACGTGGCAAGTTCTGTACCT
>probe:Drosophila_2:1631909_at:223:365; Interrogation_Position=703; Antisense; GAATAGTCGTCTAGCCGTAGTCTTA
>probe:Drosophila_2:1631909_at:376:233; Interrogation_Position=727; Antisense; AATGCGTGCGTGGAACTGTGTTTAA
>probe:Drosophila_2:1631909_at:291:317; Interrogation_Position=754; Antisense; GCCTGGTTTAGATTTCATCCTTTCA

Paste this into a BLAST search page for me
GGCCAGATCATCGACTACATTGCACTACATTGCACGCGACACCAAGGGACCAAGTTCAGCTTCATGTCCGAGGTGTATCCAAAGTTCCTGCACATCAACGCAGGAAGTATCGCTCTTGACCAAAAACTGAAGCCCCTTGAAGTTGATCTTAAGCGTTTGGAGGATCTCTCCGACTACTCCATTGTGCGTGATTTCGTTCTATTTCGTTCTCATGCGCAAGCGGGAATGAGAAAACCAACAGCCGCGTGCTTGGCGACGTGGCAAGTTCTGTACCTGAATAGTCGTCTAGCCGTAGTCTTAAATGCGTGCGTGGAACTGTGTTTAAGCCTGGTTTAGATTTCATCCTTTCA

Full Affymetrix probeset data:

Annotations for 1631909_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime