Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631913_at:

>probe:Drosophila_2:1631913_at:365:275; Interrogation_Position=1050; Antisense; CTTCCGTCGTCTCAATTGGGATTGA
>probe:Drosophila_2:1631913_at:710:513; Interrogation_Position=476; Antisense; GTGATAGCCGTAGTGCCATGTTTAT
>probe:Drosophila_2:1631913_at:392:699; Interrogation_Position=497; Antisense; TTATAGCCCGTTTCGGTCATTTCGA
>probe:Drosophila_2:1631913_at:652:531; Interrogation_Position=511; Antisense; GGTCATTTCGATCCCAATTTGTACA
>probe:Drosophila_2:1631913_at:425:667; Interrogation_Position=532; Antisense; TACATGCTGCGGGAGATCTATCATT
>probe:Drosophila_2:1631913_at:357:453; Interrogation_Position=546; Antisense; GATCTATCATTTTTCGTCGATGGCC
>probe:Drosophila_2:1631913_at:585:445; Interrogation_Position=657; Antisense; GATGCGACGCTTTGATAGGGTTCTA
>probe:Drosophila_2:1631913_at:706:357; Interrogation_Position=686; Antisense; GCAAATGGTGGAACTGGCTCTACAA
>probe:Drosophila_2:1631913_at:8:267; Interrogation_Position=766; Antisense; CAGGGTACCGTCATGTTTCTGTACA
>probe:Drosophila_2:1631913_at:596:695; Interrogation_Position=781; Antisense; TTTCTGTACAACGTGCTTAGCATGC
>probe:Drosophila_2:1631913_at:70:255; Interrogation_Position=810; Antisense; CAACTATCCGATACGCGTGCTGAAG
>probe:Drosophila_2:1631913_at:52:103; Interrogation_Position=843; Antisense; AGAGCTAATCGAGCACATTGGCAAG
>probe:Drosophila_2:1631913_at:339:251; Interrogation_Position=864; Antisense; CAAGGAATCGCTGCCGGAGGAGTAT
>probe:Drosophila_2:1631913_at:358:115; Interrogation_Position=965; Antisense; AGCAGGACTGCAACTACGGGACCAT

Paste this into a BLAST search page for me
CTTCCGTCGTCTCAATTGGGATTGAGTGATAGCCGTAGTGCCATGTTTATTTATAGCCCGTTTCGGTCATTTCGAGGTCATTTCGATCCCAATTTGTACATACATGCTGCGGGAGATCTATCATTGATCTATCATTTTTCGTCGATGGCCGATGCGACGCTTTGATAGGGTTCTAGCAAATGGTGGAACTGGCTCTACAACAGGGTACCGTCATGTTTCTGTACATTTCTGTACAACGTGCTTAGCATGCCAACTATCCGATACGCGTGCTGAAGAGAGCTAATCGAGCACATTGGCAAGCAAGGAATCGCTGCCGGAGGAGTATAGCAGGACTGCAACTACGGGACCAT

Full Affymetrix probeset data:

Annotations for 1631913_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime