FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631915_at:

>probe:Drosophila_2:1631915_at:626:665; Interrogation_Position=106; Antisense; TACATCCTGGGAATGCGCTACTACC
>probe:Drosophila_2:1631915_at:167:593; Interrogation_Position=113; Antisense; TGGGAATGCGCTACTACCACTACTG
>probe:Drosophila_2:1631915_at:163:341; Interrogation_Position=122; Antisense; GCTACTACCACTACTGCACGGTCAT
>probe:Drosophila_2:1631915_at:298:143; Interrogation_Position=134; Antisense; ACTGCACGGTCATCCGACCGGAGAA
>probe:Drosophila_2:1631915_at:409:351; Interrogation_Position=15; Antisense; GCAGAAGAAGCCGATTAACACCAAC
>probe:Drosophila_2:1631915_at:519:551; Interrogation_Position=168; Antisense; GGAGCTGAAGCTCCTGGACGAGGGA
>probe:Drosophila_2:1631915_at:667:133; Interrogation_Position=185; Antisense; ACGAGGGAGCCCACGACAAGGCCAA
>probe:Drosophila_2:1631915_at:366:81; Interrogation_Position=188; Antisense; AGGGAGCCCACGACAAGGCCAAGGA
>probe:Drosophila_2:1631915_at:409:293; Interrogation_Position=26; Antisense; CGATTAACACCAACACGCTGCTGGA
>probe:Drosophila_2:1631915_at:347:133; Interrogation_Position=59; Antisense; ACCGCGGCGCGGTGTATGCCTGCAT
>probe:Drosophila_2:1631915_at:43:485; Interrogation_Position=72; Antisense; GTATGCCTGCATTGGAGTCACCCTG
>probe:Drosophila_2:1631915_at:493:619; Interrogation_Position=79; Antisense; TGCATTGGAGTCACCCTGTACGGCA
>probe:Drosophila_2:1631915_at:207:681; Interrogation_Position=83; Antisense; TTGGAGTCACCCTGTACGGCACCTA
>probe:Drosophila_2:1631915_at:593:487; Interrogation_Position=96; Antisense; GTACGGCACCTACATCCTGGGAATG

Paste this into a BLAST search page for me
TACATCCTGGGAATGCGCTACTACCTGGGAATGCGCTACTACCACTACTGGCTACTACCACTACTGCACGGTCATACTGCACGGTCATCCGACCGGAGAAGCAGAAGAAGCCGATTAACACCAACGGAGCTGAAGCTCCTGGACGAGGGAACGAGGGAGCCCACGACAAGGCCAAAGGGAGCCCACGACAAGGCCAAGGACGATTAACACCAACACGCTGCTGGAACCGCGGCGCGGTGTATGCCTGCATGTATGCCTGCATTGGAGTCACCCTGTGCATTGGAGTCACCCTGTACGGCATTGGAGTCACCCTGTACGGCACCTAGTACGGCACCTACATCCTGGGAATG

Full Affymetrix probeset data:

Annotations for 1631915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720